1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ryzh [129]
3 years ago
15

LCM of 56f³g² and 70fg³. A. 7fg² B. 7f³g³ C. 280f³g³ D. 280fg²

Mathematics
1 answer:
nlexa [21]3 years ago
6 0
It’s most likely answer D
You might be interested in
How to you solve 4(3-6a) = 36
Lera25 [3.4K]
4(3-6a)=36
4(3-6a)/4=36/4    divide by 4 on both sides
3-6a-3=9-3         subtract 3 on both sides
-6a/-6=6/-6          divide by -6 on both sides
<span>a=-1                    solution</span>
5 0
3 years ago
Read 2 more answers
You randomly select one card from a 52 card deck. Find the probability of selecting the eight of hearts or the seven of clubs.
givi [52]

Answer:

2/52 is the answer of this question

4 0
3 years ago
What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
Papessa [141]

Answer:

AATTGGCCATGCATGATTACGA

TTAACCGGTACGTACTAATGCT

Step-by-step explanation:

A's and T's, C's and G's. Just switch the letters for their partner.

8 0
3 years ago
Read 2 more answers
For the function f(x)=-3x+2, find f(2)=
dsp73

Answer: f(2) = -4

Step-by-step explanation: Here we're given the function f(x) = -3x + 2 and we are asked to find f(2).

In other words, if we put an <em>x</em> into our function, we get a -3x + 2 out so what happens when we put a 2 into the function?

Well if we put a 2 into the function,

that's f(2) and we get -3(2) + 2 out.

Now all we have to do is simplify on the right side.

-3(2) is -6 so we have -6 + 2 which is -4.

So f(2) is -4.

8 0
3 years ago
What are the slope and the y- intercept of the linear function
3241004551 [841]

the slope is 9 and the y-intercept is - 2

the equation of a line in ' slope-intercept form ' is

y = mx + c ( m is the slope and c the y-intercept )

y = 9x - 2 is in this form

with slope m = 9 and y-intercept c = - 2



5 0
3 years ago
Other questions:
  • When Andrei surveyed 36 random seventh-grade students in the lunchroom, he found that 7 out of 9 would like to try or have alrea
    6·1 answer
  • Claire is 12 years old. Her brother roger is 4 years old, and their mother is 36 years old. Which fraction shows the ratio of Cl
    10·2 answers
  • Jonathan and Tim want to predict how many quarters are in a large jar containing 120 coins. Jonathan randomly selects a sample o
    7·2 answers
  • Wesley learn that 3/10 of the students in his class or left-handed write 3/10 as a fraction with a denominator of 100 and as a d
    14·1 answer
  • How many 5/11 inch pieces can be cut out of a piece of wood that is 60 inches long?
    9·1 answer
  • Solve algebraically for x: 2(x – 4) 2 + 10 = 30
    11·1 answer
  • Russell sold 40 shares of a stock. The value of each share has decreased by $1 since he bought the stock. Express the amount Rus
    14·1 answer
  • A round cushion has a radius of 30 inches. What is the approximate area of the cushion?
    12·1 answer
  • A rectangle's perimeter is equal to 27 plus its width. The length of the rectangle is four times its width. What is the
    12·1 answer
  • PLEASE HELP ME I AM STUCK
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!