1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
scoray [572]
3 years ago
7

In general, an enzyme has one active site at which catalysis can occur. when the substrates are bound to the active site, the en

zyme will catalyze the reaction. as the concentration of substrate increases, the reaction rate increases, until the point where the active site is saturated with substrate. when the enzyme is saturated, the rate of the reaction will not increase with the concentration of substrates.
Biology
1 answer:
Stolb23 [73]3 years ago
5 0
What is the question??
You might be interested in
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
During endocytosis, cells _____. expel what they don't need take in what they need shrink due to loss of water
AysviL [449]
Actively transport molecules across the cell membrane
8 0
3 years ago
All _______ reproduce sexually through the use of flowers in a process that involves pollination.
vivado [14]
The answer would be : a. angiosperms.

Source : https://en.wikipedia.org/wiki/Flowering_plant

Hope this helps !

Photon
5 0
3 years ago
The fact that cats and humans are both classified as mammals provides us with which minimum of information?
Aleks04 [339]

Answer:

a. option :both have mammary glands is the correct answer right no

5 0
3 years ago
Which of the following will best be demonstrated with a submentovertex (full basal) projection of the skull?A. OrbitsB. Mandible
bonufazy [111]

Answer:

The answer is C.

Explanation:

The submentovertex or the full basal projection of the skull is used best to demonstrate the base of the skull or the base of cranium. In this method, the x-rays' direction is starting from under the chin and exiting at the vertex or the top of the skull.

I hope this answer helps.

3 0
3 years ago
Read 2 more answers
Other questions:
  • An ideal gas is held in a container of volume V at pressure p. The rms speed of a gas molecule under these conditions is v. If n
    11·1 answer
  • True or False:
    7·1 answer
  • Where does the energy for human metabolism come from
    10·1 answer
  • What is the purpose of mimicry
    7·1 answer
  • Using a punnett Square and an explanation described if I square-eyed pet mates with another square-eye pet, can they have any ro
    10·1 answer
  • What is the temperature of earths layers?
    14·2 answers
  • The model illustrates a process by which a substance is taken up by a cell. Which statements describe the process? Select the co
    13·1 answer
  • I will mark as BRANLIEST!
    6·2 answers
  • On topographic maps, contour lines that are close together indicate?
    11·1 answer
  • Help please 30 points will give brainliest
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!