1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Allushta [10]
3 years ago
12

The power that allows congress to take private property for such uses as an interstate highway or a national park is

Law
2 answers:
Svetradugi [14.3K]3 years ago
7 0
It is b the power of eminent domain
Troyanec [42]3 years ago
4 0

Answer:

B the power of eminent domain

You might be interested in
15 points.
koban [17]

Answer:

no

Explanation:

a motive is not an element of a crime

6 0
3 years ago
Read 2 more answers
In one of his tweets, President Trump wrote about so-called "Obama judges". Chief Justice Roberts responds by saying "there are
charle [14.2K]

Answer:

They are both right because Barack Obama was the one who elected the justices into the Supreme Court but they are of course in no way connected to Barack Obama except for the fact that he was the one who elected them into the court.

7 0
3 years ago
Stephen has been sentenced to five years in prison after being found guilty of burglary. However, he has demonstrated extremely
inessss [21]

Answer:

The answer according to the severity of crime would most likely be probation.

Explanation:

The judge will grant probation and the inmate has to comply with the terms.

6 0
3 years ago
Read 2 more answers
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
Which statement conveys the idea in the most concise and precise manner? A) The pitcher tossed the ball to the boy. B) The pitch
bixtya [17]

Answer:C.

Explanation:

3 0
4 years ago
Other questions:
  • In the Katz vs United States case what is the constitutional issue involved in this case
    9·1 answer
  • Which is the most important speech given at the national convention?​
    5·1 answer
  • Question 1 (1 point)
    15·1 answer
  • I’m bored <br> Talk to me if you’re sad
    11·2 answers
  • The central bank of the United States is the blank
    11·1 answer
  • Which situation is the best example of competition in an economic system? A restaurant just opened down the block from a movie t
    12·1 answer
  • Which type of insurance would a person most likely purchase if he or she
    10·2 answers
  • A witness in a court case can never talk about the crime outside the courtroom.
    12·2 answers
  • Prove to me that you're honest – in less than 250 words. Please do not say something like I just am. Give me evidence and proof.
    9·1 answer
  • License fees are imposed in the exercise of police power. <br> True or False
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!