1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
natta225 [31]
3 years ago
5

If you climbed up a hill,which of these statements would be true ​

Biology
2 answers:
MissTica3 years ago
8 0
C because yeah it’s c
mr Goodwill [35]3 years ago
7 0

Answer:

A. your weight would increase because you're farther away from Earth's center

Explanation:

honestly I'm guessing

let me know if this helps

You might be interested in
Is this a frameshift mutation
Neporo4naja [7]

Answer:

3 yes because the nucleotides/nitrogen bases moved

3 0
2 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
What are the three examples to justify Newton first law of motion .​
Sergeu [11.5K]

Explanation:

1.Law of Inertia

<em>Inertia</em><em> </em>: is the ability to resist change in motion.

<em>Example</em><em>;</em><em> </em><em>if you roll a ball it will keep running unless you</em><em> change </em><em>it's</em><em> </em><em>direction with the help of </em><em>friction.</em><em>.</em>

2. second law of motion states that an object will accelerate when an unbalanced force is applied on a mass..

<em>unbalanced force is a type of force</em><em> where total force</em><em>≠</em><em>zero</em><em>,</em><em> </em><em>means the object will move</em><em>.</em><em>.</em>

<em>Example</em><em>;</em><em> if you will try to push a truck</em><em> will be less but if you push a car the acceleration will be more</em><em>.</em><em>.</em><em> because </em><em>c</em><em>ar has less </em><em>mass.</em><em>.</em>

<em>3</em><em>.</em><em> the third law of motion state that foreign every</em><em> action there is a opposite reaction</em><em>.</em><em>.</em>

<em>Example</em><em>;</em><em> can you throw a ball on the floor </em><em>.</em><em>.</em><em>.</em><em>the floor </em><em>pushes</em><em> </em><em>back</em><em> that the ball</em><em>.</em><em>.</em>

hope it helps

5 0
2 years ago
Many exergonic reactions fail to happen at a reasonable rate (e.g. conversion of diamonds to charcoal). This is due to the fact
just olya [345]

Answer: Option b

Explanation:In chemistry,

before any reaction would occurs, reactat must be able to overcome some certain amount of energy which is called the activation. The activation energy is usually the heat that is suppled.it is also refered to as the minimum energy needed before any reaction can take place. For reaction to take place, there must be an equilibrium( at constant temperature and pressure.

5 0
3 years ago
How are mutations prevented during DNA replication?
Ulleksa [173]
B. trna molicules check the amino acid for errors

3 0
3 years ago
Read 2 more answers
Other questions:
  • As the cell plate of a plant cell dissolves what happens next
    12·1 answer
  • Which action reflects promotion of genomic care as part of comprehensive health care?
    14·1 answer
  • A geographic information system (GIS) helps scientists visualize, analyze, and interpret data about locations on Earth. Which st
    14·1 answer
  • It takes a large number of __________ to support a small number of primary consumer's
    7·1 answer
  • Name three adaptations of reptiles that enable them to live on land.
    6·2 answers
  • If a man has type ab blood and his wife has type o blood what is the probability that they have a type o child
    10·1 answer
  • What is the benefit of the floating logs in Spirit Lake?
    7·1 answer
  • Which discovery is most directly related to careers in biology?
    14·1 answer
  • White fluffy clouds form high up in the sky is an example of what
    9·1 answer
  • How do non-native species affect the populations within the ecosystem where they are introduced?
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!