1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Paul [167]
2 years ago
12

A chlorine atom that has 17 protons and 18 neutrons is calls

Biology
1 answer:
Westkost [7]2 years ago
8 0

This is a neutral atom of chlorine.

You might be interested in
SOMEONE WHOS GOOD AT SCIENCE I BEG U HELP. ILL GIVE U A LOT POINTS. Fill in/ answer as many from the pic as u can, pls don’t gue
Kamila [148]

Answer:

can you snap the picture again and please make it straight when snapping, maybe I can help you

8 0
3 years ago
Read 2 more answers
An ecosystem can be best defined as which of the following? a. all of the interactions between physical processes and the abioti
Travka [436]
I believe it’s c. Hope it helps :)
8 0
2 years ago
Read 2 more answers
Is Earth closest to the sun during the month of August ?
slega [8]

No, that would be January.

6 0
2 years ago
Read 2 more answers
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
2 years ago
Read 2 more answers
What is fibrous root system?​
asambeis [7]

Answer:

Explanation:

The fibrous root is one of the small hair-like roots of the fibrous root system. Fibrous roots are derived from the base of the plant. This root system is available mainly in Monocotyledons, Gymnospermae (conifers) and Pteridophyta (ferns). Most of the fibrous roots grow horizontally and very few roots grow vertically to anchor the plant. Most importantly, the fibrous roots are short. They grow near the surface of the soil, not deep into the soil.

6 0
2 years ago
Read 2 more answers
Other questions:
  • 20. View the above sex-linked recessive pedigree. Can you be certain of generation I, individual #1's
    5·1 answer
  • Diatoms are one of the most common types of phytoplankton in marine habitats.
    10·1 answer
  • Which represents the collection of chemical reactions that occur in a cell? ATP assembly metabolism growth and repair reproducti
    7·2 answers
  • What are the examples of pond succession?
    13·1 answer
  • Two chickens are bred and have five offspring, shown below. What are the most likely genotypes of the parents?
    15·2 answers
  • The ATP molecule shown consists of a base,__________, and a chain of three phosphates. A) cellulose B) maltose C) ribose D) sucr
    12·1 answer
  • How do liver and the pancreas aid in the digestive process?
    10·1 answer
  • Guys I need help asap.. it's due at 3:00
    6·1 answer
  • if a parent cell has 10 chromosomes, how many chromosomes will be in each daughter cell after mitosis
    11·2 answers
  • D
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!