1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
son4ous [18]
3 years ago
10

What if there was a robot that could clean up litter and pick it up from the streets how will that help the environment?

Biology
2 answers:
gogolik [260]3 years ago
6 0
A robot picking up litter would be extremely helpful, no one would have to go out and voluntary do it, and it would clean up the environment. On the other hand picking up trash is a form of punishment, like when someone gets out of jail they might have community service hours.
geniusboy [140]3 years ago
4 0
It will be better I guess because no one would do it there would just be a robot will do. It
You might be interested in
A species of moth has a 2 varieties of wing color: brown and white. As winter approaches, the trees where the moths live loose t
Morgarella [4.7K]

Assuming that this question makes reference to the survivability of the two moth variations, we can confirm that the brown-colored moth will be better adapted to survive in the winter months.

<h3>Why are the brown moths more likely to survive?</h3>

This has to do with their ability to better hide from predators. As described in the question, their primary predator are birds that hunt them while resting on the tree bark. This means that the white-colored moths will stand out against the dark tree bark and be easier prey for the birds. This will eventually lead to all the moths in the area being brown-colored through the process of natural selection.  

Therefore, we can confirm that the brown-colored moth will be better adapted to survive in the winter months due to their ability to hide from predators.

To learn more about natural selection visit:

brainly.com/question/9830102?referrer=searchResults

5 0
2 years ago
A, B, AB, and O blood groups are distinguished by:
notka56 [123]
They are distinguished by proteins on the erythrocytes.
8 0
3 years ago
Andrew is describing the water cycle in three steps, as shown in this simple model. Which statement belongs in the third region?
Makovka662 [10]

A water falls from the atmosphere as rain,ice,or snow called perticipation

Hope this helps

God bless you

Have a good day

-Kayla <3

4 0
3 years ago
Byron’s car skidded across the rain-slicked road, into oncoming traffic. He was able to regain control and avoid an accident. As
andre [41]

Answer:

Parasympathetic nervous system

Explanation:

Parasympathetic nervous system (PNS) along with sympathetic nervous system (SNS) makes autonomic nervous system (ANS). ANS controls the functioning of internal processes like digestion rate, heart rate, respiratory rate etc. During a threat or stressful situation SNS is activated. It increases heart rate, respiratory rate and directs blood flow towards peripheral muscles as a part of "fight or flight response". When the situation becomes normal, PNS is activated which restores all the vitals as a part of "rest and digest" mechanism.

Since here Byron almost got into an accident, he was scared a lot due to which his SNS was activated. Eventually when he realized that he is out of danger, his PNS got activated which returned his heart rate and blood pressure to normal levels.

4 0
3 years ago
How could the notion of maximum parsimony lead to an error in establishing an evolutionary relationship
Grace [21]

Answer:

The notion of maximum parsimony does not consider the entire evolutionary history, being able to suppress important evolutionary points that would cause errors in the evolutionary relationship of a species.

Explanation:

Maximum parsimony is a criterion for optimizing phylogenetic trees. This is because through this criterion an analysis is made of all possible phylogenetic trees of a species, observing which one is smaller and offers simpler and summary information. On the one hand, the study of the smallest phylogenetic tree can be faster and more understandable, since its information is basic and direct. However, maximum parsimony can lead to errors in the establishment of an evolutionary relationship of a species, because it suppresses the entire history of evolution of that species, being able to suppress really important points in one of the clades, which would result in an incorrect evolutionary conclusion.

6 0
3 years ago
Read 2 more answers
Other questions:
  • Dr. Bio samples some pond water to observe under the microscope. She finds the specimen above, which seems to have a clear shell
    6·2 answers
  • What is a producer in the desert
    6·1 answer
  • Which of the following is not a symptom of the second line of defense, the inflammatory response?
    5·1 answer
  • Most of the energy released by oxidizing glucose is saved in the high-energy bonds of what molecules?
    5·1 answer
  • Kyoto protocol -<br><br> How did it come about ?<br> Why are people arguing about it ?
    5·2 answers
  • How do scientists explain the discovery of crinoids in the Wasatch Mountains?
    5·1 answer
  • Which area of Earth is most similar to the sun's convection zone?
    6·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • In 1884, Hans Christian Gram described a method of staining bacterial cells while not staining surrounding animal tissues. Howev
    11·1 answer
  • How does the glycolysis reaction catalyzed by GAPDH from T. tenax differ from the reaction carried out in E. coli?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!