1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nitella [24]
4 years ago
6

Force equals mass times acceleration F=ma​

Health
2 answers:
valkas [14]4 years ago
8 0
Yes it does :)
Is there any question to that?
Alecsey [184]4 years ago
8 0
It infact does, f stands for “force”, and ma stand for “mass-acceleration”
You might be interested in
Definition of relapsed or refractory aml
Alla [95]
Relapsed (past tense) Definitions:

Verb-

1. (Of someone suffering from a disease) suffer deterioration after a period of improvement.

Noun-

1. A deterioration in someone's state of health after a temporary improvement.
8 0
3 years ago
An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​
s2008m [1.1K]

Answer:

With an eye toward understanding DNA replication, Cornell researchers have learned how a helicase enzyme works to actually unzip the two strands of DNA. The results are published in the journal Nature. At the heart of many metabolic processes, including DNA replication, are enzymes called helicases.

Hope it helps?

Explanation:

5 0
4 years ago
​College roommates Sergio and Giuseppe decide to start a landscaping business over the summer. When they meet up at 5:00 a.m. on
Hoochie [10]

Answer:

Option b

Explanation:

  • Consciousness alludes to one's individual attention to one's special musings, recollections, sentiments, sensations, and condition.
  • Our cognizance is our familiarity with ourselves and our general surroundings. This mindfulness is emotional and novel to us. Our cognizant encounters are continually moving and evolving.  
  • Awareness is the capacity to straightforwardly know and see, to feel, or to be discerning of occasions. All the more extensively, it is the condition of being aware of something.
8 0
3 years ago
Benefits of starch and cereals
e-lub [12.9K]

Answer:

Starch and cell wall polysaccharides (dietary fibre) of cereal grains contribute to the health benefits associated with the consumption of whole grain cereal products, including reduced risk of obesity, type 2 diabetes, cardiovascular disease and colorectal cancer.

6 0
3 years ago
An arteriovenous fistula is a surgical anastomosis of an artery with a vein, bypassing the capillary bed, to allow the faster fl
LenKa [72]
An arteriovenous fistula is the joining of your vein and artery to make a safer, faster connection for your dialysis.
An arteriovenous graft is similar, but uses a tube that we put in, instead of relying on the vein and artery alone.
7 0
3 years ago
Other questions:
  • Sabrina needs to store some dry ingredients and wants to make sure that she properly stores this food with the necessary tempera
    11·1 answer
  • At least half of your grain servings should be ___________products each day.
    13·2 answers
  • PLZ HELP FAST 1.Learning a new skill can __________ your self-respect and confidence.   A. decrease   B. increase
    5·2 answers
  • What is the main function of a nurse in a multidisciplinary team
    14·1 answer
  • Why is it important to understand schizophrenia?
    6·2 answers
  • What was the original purpose of fidget spinners?
    13·1 answer
  • Nilai m apabila n =-15​
    13·1 answer
  • A manufacturer makes a claim about its product in a TV commercial. Which is the best way to tell whether the claim is genuine?
    11·2 answers
  • Which statement best describes how physical activity impacts national health care costs?
    11·1 answer
  • What is the difference between a medical savings account and a health savings account
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!