Answer:
Most likely diagnosis is Basal Cell Carcinoma (BCC), most likely caused by years of prolonged exposure to sunlight over time.
Explanation:
Basal Cell Carcinoma (BCC) is a common type of skin cancer that develops when the basal cells that is responsible for producing new skin cells when they die, become mutated and causes the basal cell to abnormally multiply rapidly and continues to grow. The accumulation of these abnormal cells is what results in cancerous tumors that appears like ulcers on the skin. Prolong and intense exposure to the ultraviolet (UV) radiation from sunlight has been linked to the most likely cause for the mutation of the DNA in the basal cells which leads the abnormal cell growth and multiplication. People who expose themselves to the radiation of the sun for longer periods, over time, are at high risk of developing this cancer.
Answer:
Option B, chemical energy to thermal energy
Explanation:
All living organism feed on food that contains energy in the form of chemical energy. Once the food is intake and processed for fulfilling energy requirement of all metabolic processes with in a cell, the remaining energy is released as heat (thermal energy). Thus, an amoeba while consuming a sugar molecule converts chemical energy with in the sugar to thermal energy in the form of energy molecules.
Hence, option B is correct
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Answer: Oxygen Isotopes!
Explanation: I just took the quiz and I got it correct!
If someone pours salt water on a plant that is supposed to receive fresh water, the effects on the plant are swift and severe, beginning with the draining of existing water out of the plant cell.<span> Then, the cell membrane separates from the cell wall in a process known as plasmolysis. Ultimately, the plant shrivels up and no longer thrives</span>
