1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
erastovalidia [21]
3 years ago
6

How many sex chromosomes does a human haploid cell contain?

Biology
1 answer:
umka2103 [35]3 years ago
4 0

Answer:

2

Explanation:

A human haploid cell has two sex chromosomes, a XX (female) and a XY (male)

You might be interested in
Evolution occurs by a process called ______. a Mixing b Artificial selection c Natural Selection d Artificial Insemination
kolbaska11 [484]
C.) natural selection
8 0
4 years ago
Mary has type A blood. Her son Bill has type AB blood. Which blood type does Bill's dad have if he is homogenous for blood type?
Murrr4er [49]

Answer:

Answer B

Explanation:

5 0
3 years ago
Read 2 more answers
Which cell structure contains the cell’s genetic material and controls the cell’s activities
Goshia [24]

Answer:

The nucleus.

Explanation:

The nucleus functions like the brain in humans.

6 0
3 years ago
A _____ shows family relationships and the presence or absence of a trait in each member. a Punnett square b genome c karyotype
lina2011 [118]

Answer:  D, a pedigree.

Explanation:

Pedigrees are used to analyze the pattern of inheritance of a particular trait throughout a family.

8 0
3 years ago
Which is a highly contagious bacterial infection of the lungs? tuberculosis streptococcus meningitis emphysema?
Eddi Din [679]

The right option is Tuberculosis

Tuberculosis is a contagious, airborne disease of the lungs caused by the bacterium; Mycobacterium tuberculosis. The bacteria is released from the lungs into the air when an infected person sneezes, spits, or cough and this makes the disease highly contagious as it can be easily transmitted to others.







3 0
3 years ago
Other questions:
  • HELP!!!!!!!!!
    8·2 answers
  • Suppose that the pedigree shown in the transparency is for a trait caused by recessive allele.is it possible to infer from the p
    9·1 answer
  • When energy is transformed from one
    14·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • I need some help with this question
    6·2 answers
  • What is made up of fossils
    6·2 answers
  • Stella thinks that if people are exposed ultraviolet light then they are more likely get skin cancer. Stella designs an experime
    13·2 answers
  • Insecticides were first created to combat <br> _______ that were destroying potato crops.
    14·1 answer
  • When does the mountain banshee become prey?
    5·2 answers
  • Why does the moon appear to change shapes in the sky?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!