1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Andrews [41]
3 years ago
13

Chapter 7 cell structure and function

Biology
1 answer:
MariettaO [177]3 years ago
4 0
What are you asking I would love to help
You might be interested in
Please help for test due today
Darina [25.2K]

Answer:

a

Explanation:

4 0
3 years ago
Assembling a complete sequence from fragment sequences
Soloha48 [4]

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.

7 0
3 years ago
Explain how water, glucose and mineral salts are transported through a plant
spayn [35]

Answer:

Plants have tissues to transport water, nutrients and minerals. Xylem transports water and mineral salts from the roots up to other parts of the plant, while phloem transports sucrose and amino acids between the leaves and other parts of the plant.

 

pls mark brainliest. Thank you

8 0
2 years ago
7. The periodic table has changed over time as new elements have been added to it. Which
damaskus [11]

Answer:

it will be the answer B. scientists discover new elenents.

6 0
2 years ago
What happens to the pH of the battery acid if you dilute it to a 0.1 M solution (0.1L battery acid and water to 1.0L)?
Diano4ka-milaya [45]
It becomes more alkaline where pH will be more than 8
4 0
3 years ago
Other questions:
  • Describe the consequences of global warming to a regional community? What are 3 causes and effects of global warming? list credi
    5·1 answer
  • How do we separate human skull from primates?
    11·1 answer
  • What is the human female reproductive system is adapted for? A. Production of zygotes in ovaries B. External fertilization of ga
    9·1 answer
  • A group of genes that operate together are known as
    8·2 answers
  • A karyotype of a person with Down syndrome is shown here. Which term is used to describe this type of genetic disorder?
    12·1 answer
  • BRAINLIESTTT ASAP!!!!
    10·1 answer
  • HELP PLS!!!!!!
    15·1 answer
  • Match with the correct pattern of inheritance.
    7·1 answer
  • The cytoplasm and two nuclei that are formed during mitosis are separated into two identical daughter cells during _______. A. P
    6·1 answer
  • DNA is composed of repeating structural units
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!