Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
 
        
             
        
        
        
Answer:
Plants have tissues to transport water, nutrients and minerals. Xylem transports water and mineral salts from the roots up to other parts of the plant, while phloem transports sucrose and amino acids between the leaves and other parts of the plant.
   
pls mark brainliest. Thank you
 
        
             
        
        
        
Answer:
it will be the answer B. scientists discover new elenents.
 
        
             
        
        
        
It becomes more alkaline where pH will be more than 8