1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sergio039 [100]
3 years ago
6

According to the computer model mode bye gilbert and kittel what will happen if world warm by 4'c

Biology
1 answer:
Gennadij [26K]3 years ago
3 0

Answer:

The correct answer is - ice shelves will have at risk of collapse.

Explanation:

Ella Gilbert and Christoph Kittel at the University of Reading, UK, and the University of Liege, Belgium, respectively made a computer model for the effect on ice shelves by climate change.

They found that if the world warms by 4°C, the continent’s ice shelves, approximately 34% will have melted water on their surface, which is known as hydrofracturing and a sign that these ice shelves are at risk of collapse.

You might be interested in
Different between GNP and GNI.​
Y_Kistochka [10]

Answer:

The main difference is that GNP (Gross National Product) takes into account net income receipts from abroad. ... GNI (Gross National Income) = (similar to GNP) includes the value of all goods and services produced by nationals – whether in the country or not.

Mark as brainliest

4 0
3 years ago
Read 2 more answers
What role does cellular respiration play in the water cycle
olga55 [171]

The correct answer is:

It releases H2O to the atmosphere during electron transport.

Explanation:

Cellular Respiration is the process that occurs in the living cells where sugar or glucose is oxidized in carbon dioxide and water ending in the release of energy in the formation of adenosine triphosphate (ATP).This is the method by which the chemical energy stored in the biomolecules is transformed into energy which can be utilized by the cells for processes like transportation of molecules, movement, and biosynthesis.


8 0
3 years ago
Read 2 more answers
1. Explain the function of white blood cells in the body.
Wittaler [7]

Answer:1. White blood cells are part of the body's immune system. They help the body fight infection and other diseases.

2. Red blood cells have adaptations that make them suitable for this.

3. The blood would not clot in case of an injury.

4. Blood supplies essential substances and nutrients.

Explanation: 1. White blood cells are able to recognize viruses and/or infectious germs, which is how they fight off disease/sickness. It is also why we have vaccines. Vaccines put either dead or weakened parts of a germ into your body. Then, the white blood cells recognize it and fight it off the next time it enters your body.

2. They contain hemoglobin, a red protein that combines with oxygen. They have no nucleus so they can contain more of the hemoglobin. they are small and flexible so that they can fit through narrow blood vessels.

3. This will lead to excess blood loss and can even lead to the death.

4. Such as as sugar, oxygen, and hormones to our cells. It also carries waste away from the cells, this waste is eventually flushed out of the body in urine, feces, sweat, and lungs.

3 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
10 lines about any extinct animal in hindi
Archy [21]

Answer:

hi

Explanation:

डोडो (रफस क्यूक्यूलैटस) एक विलुप्त उड़ान रहित पक्षी है जो हिंद महासागर में मेडागास्कर के पूर्व मॉरीशस के द्वीप के लिए स्थानिकमारी वाला था। डोडो के सबसे करीबी आनुवांशिक रिश्तेदार भी विलुप्त रोड्रिग्स सॉलिटेयर थे, दोनों कबूतरों और कबूतरों के परिवार की उपपरिवार रफैनी थे। डोडो का सबसे करीबी जीवित रिश्तेदार निकोबार कबूतर है। एक सफेद डोडो को कभी रियूनियन के पास के द्वीप पर मौजूद माना जाता था, लेकिन अब रियूनियन इबिस और सफेद डोडो के चित्रों के आधार पर भ्रम की स्थिति पैदा हो गई है।

सबफॉसिल अवशेष दिखाते हैं कि डोडो लगभग 1 मीटर (3 फीट 3 इंच) लंबा था और जंगली में इसका वजन 10.6–17.5 किलोग्राम (23-39 पाउंड) हो सकता है। जीवन में डोडो की उपस्थिति केवल 17 वीं शताब्दी के चित्र, चित्रों और लिखित खातों से ही स्पष्ट होती है। जैसा कि ये काफी भिन्न होते हैं, और केवल कुछ दृष्टांतों को ज्ञात नमूनों से खींचा गया है, जीवन में इसकी सटीक उपस्थिति अनसुलझी बनी हुई है, और इसके व्यवहार के बारे में बहुत कम लोग जानते हैं। हालांकि डोडो को ऐतिहासिक रूप से मोटा और अनाड़ी माना जाता रहा है, लेकिन अब यह माना जाता है कि इसके पारिस्थितिकी तंत्र के लिए इसे अच्छी तरह से अनुकूलित किया गया है। यह भूरा-भूरे रंग की परत, पीले पैर, पूंछ के पंखों के एक गुच्छे, एक ग्रे, नग्न सिर, और एक काले, पीले और हरे रंग की चोंच के साथ चित्रित किया गया है। यह अपने भोजन को पचाने में मदद करने के लिए गिज़र्ड पत्थरों का इस्तेमाल करता था, जिसके बारे में माना जाता है कि इसमें फल भी शामिल हैं, और माना जाता है कि इसका मुख्य निवास स्थान मॉरीशस के सूखे तटीय क्षेत्रों में जंगल रहा है।

3 0
3 years ago
Read 2 more answers
Other questions:
  • What planet has no moon and a dense atmosphere
    9·2 answers
  • Why is biomass considered a renewable resorce?
    5·2 answers
  • Human populations in low-UV environments tend to have more lightly pigmented skin. One explanation is that the selective pressur
    12·1 answer
  • How does soil quality affect the characteristics of ecosystems?
    6·2 answers
  • Which of these statements is correct about a theory?
    15·2 answers
  • What are the two land biomes with the warmest temperatures?
    8·2 answers
  • We presume that meiosis evolved later than mitosis. What process would not have to evolve in cells undergoing meiosis in order t
    12·1 answer
  • which of the following terms does not refer to the shape of a bacterium? a. tetanus b. coccus c. spirillum d. bacillus
    15·2 answers
  • Explain how seasons are similar and different on your Uranus as compared to the Earth.​
    10·1 answer
  • How is blood different after it is pumped through the capillaries in the intestines?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!