1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anna [14]
3 years ago
15

A good hypothesis can be formed only after asking a scientific question.

Biology
2 answers:
Dovator [93]3 years ago
7 0
I believe the answer is C.
leonid [27]3 years ago
6 0

Answer:

C

Explanation:

You might be interested in
Sedimentary rocks are formed when soil, rocks, or the remains of dead organisms undergo layering and compaction over a long peri
Tasya [4]

D.) The original items making the rock.

6 0
3 years ago
Read 2 more answers
ESS3-1 Mesopotamia used continuous irrigation to get water to their crops. Egypt constructed basins that
ArbitrLikvidat [17]

my gosh...!! Your eyes are so scary....⊙﹏⊙

6 0
3 years ago
Read 2 more answers
Which of the following statements are true of anatomy and physiology?
ANTONII [103]

Answer:

Option D and E

Explanation:

Hope it was helpful for u

5 0
2 years ago
What are the 2 stages of solidification, and what occurs during each?
jenyasd209 [6]

Molten material is allowed to solidify into the final shape.

Casting defects occur during solidification:

Gas porosity

Shrinkage

Two stages of solidification:

Nucleation

Growth

4 0
3 years ago
A germ cell of an organism has 60 chromosomes in it. It undergoes meiosis, and at the end it produces four daughter cells. What
konstantin123 [22]

Explanation:

the answer is c.= because meiosis is the reproduction of a germ cell with 60 chromosomes. involves splitting 60 chromosomes in half, so each cell will have 30 chromosomes in each cell..

6 0
3 years ago
Other questions:
  • Which is the highest level of biodiversity?
    12·1 answer
  • What is the best explanation for way a cell might shrivel
    5·1 answer
  • Wild forest pigs called peccaries feed on plant bulbs, other plant roots, insects, and small animals. What can you infer about p
    9·1 answer
  • Your science class has taken swabs throughout the school. The image shows the petri dish containing a bacterial culture that dev
    5·2 answers
  • Match each description to the correct step. Metaphase 11 Nuclear membranes form around each set of chromosomes. Prophase 11 Chro
    5·1 answer
  • What are some effective ways to clean-up polluted water? Support your answer
    9·1 answer
  • James and his family live on a large farm that produces grain, cotton, and peanuts. He and his father have been trying to get a
    10·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • A full explaination of osmosis. Please I need it fast​
    14·2 answers
  • The heat absorbed/added to the material causes the material to change its form from?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!