1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sp2606 [1]
3 years ago
11

A chromosome has undergone a translocation that has completely deleted its centromere region, preventing association with spindl

e fibers. Other than this loss of sequence, the remaining DNA of this chromosome is undamaged. What will be the fate of this cell?
Biology
1 answer:
kobusy [5.1K]3 years ago
5 0

Answer:

<h2>The cell will not pass the M checkpoint because its chromosomes will not associate with spindle fibers. or if the cell goes complete division, then the homologous chromosomes will go into either daughter cell.</h2>

Explanation:

 As in the cell cycle, there are various checkpoints, which checks the cell in many steps like G1/S checkpoint, G2, M  etc. They check the integrity of the genome, if there is any defect in the DNA/chromosome, it arrest the cell cycle.

Centromere is the region on the chromosome which binds with spindle fibers and is used in the separation of chromosomes during anaphase of cell cycle. If there is deletion of centromere, then the separation of chrmosome will be affected. Then the homologous chromosome can either go into one of the daughter cell, so one cell will get 2n+1 and other will get 2n-1.

You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
What is exact name of..<br> Thick Walled isodiametric dead cells
bulgar [2K]

Answer:Sclerenchyma

Explanation:Sclerenchyma is thick walled dead lignified cells, they are hard and elastic. The sclerenchyma cells are divided into two groups namely fibers and sclereids. Sclerenchymatous fibers are branched/unbranched, long, hard, pointed cells with tapering ends, thick walls, and narrow lumen.

8 0
3 years ago
Read 2 more answers
Producers, like this plant, take in oxygen and release carbon dioxide during __________________ , just like animals and other li
White raven [17]
My answer would be cellular respiration.

Hope this helps!
6 0
3 years ago
Read 2 more answers
Starting from the sun, create a food chain including at least three organisms. Explain how energy is transferred through the cha
Kryger [21]

Answer:

The food chain showing seven organisms can be drawn as follows:

Plants → grasshoppers → mice → frog → snakes→ eagles → decomposers

The plants are the primary source of food in a food chain or a food web. The animals which feed on plants will be termed as herbivores or primary consumers like the grasshopper. The organisms feeding on primary consumers will be the secondary consumers like mice.

An energy pyramid for three of the organisms can be shown as follows:

              mice (10 kilocalories)

                   ↑

        Grasshoppers (100 kilocalories)

                   ↑

       Plants ( 1000 kilocalories)

As the energy pyramid shows, only about 10% of the energy travels from one trophic level to another.

Explanation:

6 0
2 years ago
A train travels 800 kilometers in 6 hours. What is the average speed of the train?
erica [24]
Answer: 133 km/h

Explanation
7 0
2 years ago
Other questions:
  • The hypothesis that suggests that life formed near the earth's surface in pools of water is called
    9·1 answer
  • SOMEONE HELP ASAP!! 20 POINTS!!
    6·2 answers
  • Which of the following life cycle stages do both complete and incomplete metamorphosis of insects have in common?
    7·1 answer
  • PLEASE HELP ME
    11·1 answer
  • The trait for Huntington's disease in humans shows a dominant pattern of inheritance. The alleles for Huntington's disease in tw
    10·2 answers
  • Evidence that ____ with your prediction supports your hypothesis
    14·1 answer
  • if a red blood cell has solute of concentration of 0.9%, what would be the solute concentration of an isotonic solution
    7·1 answer
  • A scientist believes that she has found a new life form. Which of the following conditions is not considered essential in determ
    11·1 answer
  • Is the Great Green Wall an example of Secondary Succession?
    15·1 answer
  • Explain why the trees in the eastern half of the study area were smaller than the trees in the western half.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!