1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Xelga [282]
2 years ago
14

NEED HELP ASAP MARK YOU BRAINLIEST what is 30+35+30=

Mathematics
1 answer:
Degger [83]2 years ago
7 0

Answer:

95

Step-by-step explanation:

30+30 is 60

60+35 is 95

Another way to do this is to use multiplication then add. (30x2=60)

Hope I helped!

You might be interested in
A perfume manufacturer uses 0.875 pounds of rose petals to make each bottle of perfume. How many pounds of rose petals would be
trapecia [35]
To solve this problem
Let X be pounds of rose petals needed.
ATQ
0.875 pounds of rose petals are in 1 bottle.
So, 0.875 / 1 = X / 86
( because we have to find how many petals {in pounds}are there  in 86 perfume bottles )
cross muliplying both side.
0.875 * 86 = X
75.25 = X
So, there are 75.25 pounds of petals in 86 perfume bottles.
8 0
3 years ago
Read 2 more answers
What is 0.01 rounded to the nearest hundredth
Novosadov [1.4K]

Answer:

It is already rounded to the nearest tenth! Hope this helps!

Step-by-step explanation:

4 0
2 years ago
Read 2 more answers
9/20
Stella [2.4K]

<u>Question:</u>

Find the number of real number solutions for the equation. x^2 + 5x + 7 = 0

<u>Answer:</u>

The number of real solutions for the equation x^{2}+5 x+7=0 is zero

<u>Solution:</u>

For a Quadratic Equation of form : a x^{2}+b x+c=0  ---- eqn 1

The solution is x=\frac{-b \pm \sqrt{b^{2}-4 a c}}{2 a}  

Now , the given Quadratic Equation is x^{2}+5 x+7=0  ---- eqn 2

On comparing Equation (1) and Equation(2), we get

a = 1 , b = 5 and c = 7

In x=\frac{-b \pm \sqrt{b^{2}-4 a c}}{2 a} , b^2 - 4ac is called the discriminant of the quadratic equation

Its value determines the nature of roots

Now, here are the rules with discriminants:

1) D > 0; there are 2 real solutions in the equation

2) D = 0; there is 1 real solution in the equation

3) D < 0; there are no real solutions in the equation

Now let solve for given equation

D= b^2 - 4ac\\\\D = 5^2 - 4(1)(7)\\\\D = 25 - 28 \\\\D = -3

Since -3 is less than 0, this means that there are 0 real solutions in this equation.

4 0
3 years ago
Complete the inequality statement.<br><br> 8 ___ 8<br><br> &gt;<br> &lt;<br> =
murzikaleks [220]

Answer:

8 = 8

Step-by-step explanation:

If the numbers are the same, they are equal ( = )

7 0
2 years ago
Select the postulate that is illustrated for the real numbers.
jeka57 [31]
The answer would be 1. The commutative postulate for multiplication. Hope this helped! Good luck! :)
6 0
3 years ago
Read 2 more answers
Other questions:
  • What is the recursive rule for this geometric sequence?
    10·1 answer
  • The base of f(x)=2^x is
    14·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Kate and John ran a marathon, a distance of 26.2 miles. Kate's time was 4 hours, 36 minutes. John's time was 4.6 hours. Compare
    13·1 answer
  • Please help me answer these. I am not good at graphs and this is overdue and i need this done. Will mark brainliest.
    11·1 answer
  • I will give 40 points to the person who has the awnser and work solved to all 5 questions
    6·2 answers
  • Please select the word from the list that best fits the definition warned that going to a temple was not enough; all must work f
    8·1 answer
  • Flying against the wind, a jet travels 5920 miles in 8 hours. Flying with the wind, the same jet travels 10.980 miles in 9 hours
    13·1 answer
  • I need help please with linear function
    8·1 answer
  • Someone help me solve this please ASAP
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!