First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Answer:
During the G1 phase, cells synthesize and grow mRNA and proteins for DNA synthesis.
Explanation:
*this is based on the assumption that parent two is homo_zygous dominant.
If a hetero_zygous and a homo_zygous dominant parent are crossed:
Genotypic Ratio
WW: Ww
1 : 1
Phenotypic Ratio
white : purple
[1 : 0] or [100% : 0%]
100 will have a white colour while 0 will have a purple colour.
The skin color of fish is used to demystify human skin pigmentation. As revealed by studies, a fish skin color is influenced by both genetics and the environment. For example, the skin pigmentation of fish exposed to a more saline environment and fed saltier food is different compared to fish exposed to a lower concentration of salt. Based on years of studying fish skin color, it can be deduced that the variety of human skin pigment is also influenced by genetics plus the environment.
