1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oksi-84 [34.3K]
3 years ago
12

During preshock, the compensatory stage of shock, the body, through sympathetic nervous system stimulation, will release catecho

lamines to shunt blood from one organ to another. What organ will always be protected?
Biology
1 answer:
Sliva [168]3 years ago
6 0

Answer:

Brain

Explanation:

A shock is a medical condition which is caused when the body has the less available substrates for the aerobic respiration and shift to anaerobic cellular respiration.The shock takes place in four-stage in which the second stage is the compensatory stage.

During the compensatory stage, the sympathetic nervous system gets activated to shift back the respiration from anaerobic respiration to aerobic respiration.

The sympathetic nervous system releases the epinephrine and nor-epinephrine which acts on the kidney to maintain blood pressure. During this process, the Brain is not affected by the shock condition.

Thus, Brain is correct.

You might be interested in
How do x-linked and y-linked diseases pass onto offspring?
avanturin [10]
By there DNA. When when x and y have sex they send there gene into the offspring
3 0
3 years ago
From his monohybrid crosses, Mendel developed his first law
Nikitich [7]

Answer:

Im confused but if your asking for Medel's first law it would be states that for the pair of alleles an individual has of some gene (or at some genetic locus), one is a copy of a randomly chosen one in the father of the individual, and the other if a copy of a randomly chosen one in the mother, and that a randomly chosen one will be copied

Explanation:

4 0
2 years ago
Camel humps are an adaptation for _______.. a.. storing water. b.. regulating body heat. c.. carrying riders. d.. all of the abo
Fofino [41]

The correct answer is:

b regulating body heat.

Explanation:

Camels have humps on their backs as rooms to store fat. It is this fact that they live off when food and liquid are scarce. A well-fed camel in good shape has a firm, upright hump. After a long, exhausting wilderness journey the corresponding camel will have a hump that does floppy and bent over to one side.e. Concentrating body fat in their humps reduces heat-trapping.

6 0
3 years ago
Read 2 more answers
Fill in the blank. Bacteria of viruses can cause ----------- diseases. Which are increasing in occurrences geographic area, or b
CaHeK987 [17]
The answers is infectious
6 0
3 years ago
How amphibians regulate their body temperature?
Allushta [10]
Frog temperature. Frogs are ectotherms, this means they gettheir heat from external sources. They are sometimes called 'cold blooded', but in fact they do not have cold blood, it is justregulated by their environment. In comparison, humans are endotherms and can maintain their body temperature at about 37°C.
8 0
3 years ago
Read 2 more answers
Other questions:
  • The weather is dry and warm.what changes would a cold front bring?
    15·2 answers
  • What treats the body using principles similar to acupuncture and acupressure?
    13·1 answer
  • Which of the following regions experiences its greatest solar intensity in late december?
    15·1 answer
  • Which one of the following most closely approximates the number of replicons in a human focus of replication?a. 1b. 50c. 100d. 3
    11·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Which property of matter does the intrument measure
    7·1 answer
  • Where do decomposers get their energy from A)sun B)plants C)dead plants and animals D)humans
    11·2 answers
  • I don’t understand how to do this
    7·1 answer
  • If matt and sarah have 10 children why do they all end up genetically different?
    13·1 answer
  • In the diagram below of a human skeleton, what is the name of the bone
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!