3 years ago

Describe the differences between the forces of magnetism and gravity.

1 answer:

3 0

Answer:

Gravity is not the same thing as magnetism. They are in fact entirely distinct forces. Gravity is a force that works with weight between two objects. Magnetism can pull or separate the two objects, depending on how the magnets point.

Explanation:

You might be interested in

Small structures inside cells that perform specific functions are called:

frosja888 [35]

Answer:

B. Organelles

Explanation:

they are called

6 0

2 years ago

Read 2 more answers

Explain the organic evolution

maxonik [38]

Answer:

The Theories of Organic Evolution explains convincing the origin of life. It also explains how the wide variety of plants and animals came into existence in the world. According to this theory, the world has been evolved and not been created.

Explanation:

8 0

2 years ago

Read 2 more answers

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer

quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

5 0

2 years ago

I’m confused on this question