Answer:
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Explanation:
Active transport uses energy such as plants taking in minerals while passive transport is opposite as it does not use energy.
Partial pressure of oxygen inside the alveolus is higher than in pulmonary capillary vessels, that allows oxygen molecules to diffuse into the blood.
<span>the ventricle pumps the blood out of the amphibians heart, into the body.</span>
Answer: Carbon dioxide
Explanation:
In cellular respiration, glucose is broken down to form ATP/energy. Water and carbon dioxide are also released as byproducts. Since water isn’t an option, the answer is carbon dioxide.
