1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Evgen [1.6K]
3 years ago
5

An example of maintaining homeostasis at the system level would be _____.

Biology
2 answers:
cluponka [151]3 years ago
5 0

Answer:

it would be A. the liver storing excess sugar molecules

Explanation:

omeli [17]3 years ago
4 0

Answer:

c. breathing faster while jogging

Explanation:

took the test

You might be interested in
The picture illustrates three cross sections of rock layers from three different areas.
amm1812

Answer:

hii can u PLZ put up the picture so that I can help u with this.Have a great day or night

7 0
3 years ago
In a membrane, the________of the phospholipids in one monolayer face the________of the phospholipids in the other monolayer.
matrenka [14]

In a membrane, the tail of the phospholipids in one monolayer face the tail of the phospholipids in the other monolayer.

<h3>What is cell membrane?</h3>
  • The cell membrane is a biological membrane that separates and protects the inside of all cells from the outside environment.
  • It is also known as the plasma membrane (PM), cytoplasmic membrane or plasmalemma (extracellular space).
  • The cell membrane consists of a lipid bilayer, which is made up of two layers of phospholipids interwoven with cholesterol (a lipid component) to maintain  proper membrane fluidity  at different temperatures.
  • Furthermore, membranes are composed of membrane proteins, such as those that cannot be separated across the membrane and function as membrane transporters, and peripheral proteins that simply attach to the  outer membrane of the cell and function as membrane transporters. enzymes to help the cell interact with its environment.
  • The integrated glycolipids of the outer lipid layer perform a similar function.

To learn more about the membrane, refer to the following link:

brainly.com/question/1768729

#SPJ4

3 0
1 year ago
Daughter cells formed by mitosis have exact copies of the parent cell's DNA. What process ensures that is possible?
Mrrafil [7]
So the process involves copying the chromosomes first and then carefully separating the copies to give each new cell a full set
4 0
3 years ago
large proteins such as albumin remain in capillaries rather than diffusing out, resulting in the _____.
Bumek [7]

Answer:

development of an osmotic pressure difference across capillary walls

6 0
3 years ago
I’ll mark u as brainliest!
Westkost [7]

Answer:it might be 3

Explanation:

8 0
3 years ago
Other questions:
  • Enzymes only work with specific substrates because each substrate
    14·1 answer
  • What is the major function of asters of centrosome in a cell ?
    15·1 answer
  • Malcolm is studying alone in his room late at night when he hears a loud noise downstairs. His heartbeat increases significantly
    10·1 answer
  • Does anyone understand this stuff
    5·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Does genetic drift happen in small or large populations?
    5·1 answer
  • When you are injured and bleeding the clotting factors immediately start to clot and try to seal the wound. This would be an exa
    8·1 answer
  • The gene has a mutation and is changed to the sequence below.
    12·1 answer
  • En moscas de la fruta, ojos rojos son dominantes (E). Los ojos blancos son recesivos (e). Si la mosca hembra tiene ojos blancos
    5·1 answer
  • WILL GIVE BRAINLIEST!! PLEASE HELP!!
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!