1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elenna [48]
3 years ago
14

A set of steps used to collect information and to test a hypothesis is called

Biology
1 answer:
liq [111]3 years ago
4 0

Answer:

I believe its Scientific Method

Explanation:

You might be interested in
Which of the following is a common treatment for type III hypersensitivity reactions?
mestny [16]

Answer:

Anti-inflammatory steroid treatments

Explanation:

The exaggerated or hyper active response of the immune system causes hyper sensitive reactions in the body. These immune reactions are generally uncomfortable and harmful for the body.

Type III hypersensitivity reaction mainly occur due to the neutrophils, IgG and complement. This hyper sensitivity reaction can be treated by anti-inflammatory steroid treatments as the neutrophils are the main mediators of this reaction.

Thus, the correct answer is option (1).

8 0
3 years ago
When the cell needs energy again, it can remove the third phosphate group from atp to _____ energy.
velikii [3]
ADP or adenosine diphosphate
4 0
2 years ago
Where is carbon located on our planet, and how are these carbon reservoirs different from each other?
sladkih [1.3K]

Answer: Most carbon is stored in rocks and sediments, while the rest is stored in the ocean, atmosphere, and living organisms. These are the reservoirs, or sinks, through which carbon cycles. The ocean is a giant carbon sink that absorbs carbon.

6 0
3 years ago
Explain how soaring and gliding birds use their air currents in their flight
ira [324]

Soaring and gliding birds like eagle, vulture, albatross, sea gulls etc are efficiently adapted to utilize the air currents in their flight.

Explanation:

The soaring flight and gliding movements are special adaptation developed by birds to meet the challenge of increasing turbulent air current.

Birds have the extraordinary skill of flying smoothly and effortlessly even at very high altitudes  

Birds soar by using thermal and dynamic soaring techniques.

Gliding movements help the birds to deflect the wind downward which helps to lift their bodies in the air. They do not flap their wings during gliding but just dive straight into the air which helps to increase their speed.

The adaptation of the bird’s structure with very light but strong bones on their wings helps to soar and glide in the air.

8 0
3 years ago
The diagram below shows the changes in skull structure from early hominids to
Vlada [557]

Answer: Its smaller jaw bone

Explanation: Just look at the picture

7 0
2 years ago
Other questions:
  • Anne was observing a cell under a microscope which was undergoing binary fission. Which type of cell was Anne observing? 1 Eukar
    15·1 answer
  • Which statement is correct? A. All organisms that can synthesize their food by means of photosynthesis are heterotrophic B. All
    11·2 answers
  • Why are plants found at the beginning of a food web?
    9·2 answers
  • An animal cell is placed in an aqueous solution. The cell has a solute concentration of 6%, while the aqueous solution has a sol
    8·2 answers
  • In one of her expeditions, a marine biologist finds a new and seemingly adult organism that has a distinct head but an unsegment
    9·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • A region or zone that defies the known laws of physics is called a/an O A. supernova O B. neutron star O C. duality O D. singula
    10·1 answer
  • If four cells went through mitosis at the same time how many daughter cells would be formed? ​
    7·1 answer
  • What happens to molecules of a substance during convection
    7·1 answer
  • How many meters are in 7.8 km
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!