1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zloy xaker [14]
3 years ago
6

is the movement of molecules from areas of low concentration to areas of high concentration and require energy.

Biology
1 answer:
kompoz [17]3 years ago
7 0
Yes, because it would be like shoving something into a crowed place, rather than shoving something into a uncrowded place.<span />
You might be interested in
Unlike the methods of early scientists, how did Sir Francis Bacon believe basic laws of science should be determined?
butalik [34]
<span>Unlike the methods of early scientists, Sir Francis Bacon believed basic laws of science should be determined by using inductive reasoning based on empirical evidence. You cannot formulate a law in science if you don't have evidence to support it - so you cannot just take a basic truth and formulate your law based on that - there has to be some kind of evidence to prove your theories. Also, based on those evidence, you will induce a conclusion necessary for such laws, which is something Bacon understood, unlike early scientists.</span>
3 0
3 years ago
Read 2 more answers
Which best describes the pericardium?
hammer [34]
Pericardium is a membrane that surrounds the heart and the roots of the blood vessels. It is composed of two layers: the serous layer and the fibrous layer.

The Pericardium keeps the heart in place and in proper working order. Any disorders that occurs in the pericardium will also affect how the heart works. 

Inflammation of the pericardium may be a result of infection, heart attack, heart surgery, and other medical side effects. 
5 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
All cells of the body age and are replaced in a natural order. When RBCs age, they are destroyed in the spleen. During this proc
Ad libitum [116K]

Answer:

Bone marrow.

Explanation:

Hematopiesis may be defined as the formation of the blood cells by the precursor stem cells. This process occurs in the bone marrow, thymus and liver.

The red blood cells are enucleated cells with the minimum span of around 120 days. These cells are processed and destroyed in the spleen. The iron is recovered from the red blood cells and sent again into the bone marrow for the production of new blood cells.

Thus, the answer is bone marrow.

4 0
3 years ago
How come we have 20 amino acids and they make thousands of proteins please give me reasons
Kryger [21]

Answer:

The human body uses just 21 amino acids to make all the proteins it needs to function and grow. Because amino acids can be arranged in many different combinations, it's possible for your body to make thousands of different kinds of proteins from just the same 21 amino acids.

3 0
3 years ago
Other questions:
  • Mangrove trees can only survive in moderately saline water. What are such organisms called?
    8·2 answers
  • It is estimated that _______________ of human DNA encodes protein. A) about fifty percent B) less than five percent C) more than
    10·2 answers
  • Definition: This is an inanimate object that is not composed of cells. It may be made of atoms, molecules,
    12·1 answer
  • Put the following terms in the order that oxygen passes through them to reach your blood: alveoli, lung, trachea, nose, bronchi.
    8·1 answer
  • Which disorder could develop in the human
    7·1 answer
  • When an organism encounters nitrate in its environment, which condition will determine whether the nitrate is used in an assimil
    5·1 answer
  • PLEASE HELP!!
    6·1 answer
  • Use chromosomes 11 and 17 to answer the following questions. Chromosome Map Chromosome 17 is made of over million base pairs. Ap
    8·2 answers
  • Contagious patients should enter the office from where
    9·1 answer
  • As the zygote goes through mitosis and creates more cells. Each cell is called a stem cell. In order to become a certain type of
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!