1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MAVERICK [17]
3 years ago
10

Would you expect older volcanoes to be seamounts or islands

Biology
1 answer:
sashaice [31]3 years ago
7 0

Answer: I belive they're islands because when the summit of a seamount reaches the oceans surface it <u>becomes an island.</u> Some seamounts are islands that slipped beneath the ocean's surface after they became extinct.

You might be interested in
What is the most plentiful gas in our current atmosphere on earth?
horsena [70]

Answer:

D) Nitrogen..............

8 0
3 years ago
Rachel Carson’s warning in Silent Spring was focused on _______.
sveticcg [70]
Rachel Carson's warning in silent spring was focused on : The misuse of pesticide
The book was published in 1962 and documented the effect of the use of pesticide to the environment

hope this helps

5 0
3 years ago
Read 2 more answers
Which of these statements is false? Veins always carry blood toward the heart. Veins can carry oxygen-rich blood. Arteries alway
Alex73 [517]

Answer:

Arteries never carry oxygen rich blood

Explanation:

This is totally wrong as most Arteries carry oxygenated blood away from.the heart to other organs and structures. Only the pulmonary artery carries deoxygenated blood to the lungs for oxygenation

7 0
2 years ago
Are offsprings such as Flatworms that a genetically identical to. The parent are produced by asexual or sexual reproduction?
cluponka [151]

Answer: asexual reproduction

Explanation:

6 0
3 years ago
Read 2 more answers
Ocean-dwelling chemoheterotrophic bacteria that generate energy via aerobic respiration are dependent on the presence of photoau
galben [10]
Because, photoautotrophs serves as their carbon sources.
Chemoheterotrophic bacteria are those bacteria that are incapable of producing their own food, they depend on photoautotrophs, which are capable of making their own food by trapping energy from the sun. Thus, photoautotrophs serves as source of food for the chemoheterotrophic bacteria.
6 0
3 years ago
Other questions:
  • What is the main function of starch in plants?
    8·2 answers
  • Question 4 Unsaved
    14·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • How can humans disrupt the state of dynamic equilibrium in an ecosystem?
    14·2 answers
  • Food molecules _____ that is released when it's chemical bonds are broken
    5·1 answer
  • Which process is part of the carbon cycle?
    10·1 answer
  • Which of the phrases from the paragraph is an example of a simile?
    10·1 answer
  • The main difference between an ecosystem and a community is-
    15·1 answer
  • Lets talk about ariana grande i am bored plzz
    15·2 answers
  • What other ways can organisms be classified?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!