1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bagirrra123 [75]
3 years ago
11

When body temperature increases, thermoreceptors are stimulated and send nerve signals to the CNS. The CNS sends motor signals t

o sweat glands, which attempt to reduce body temperature. This is an example of a __________ reflex.a. organ.b. stretch.c. withdrawal.d. visceral.
Biology
1 answer:
uranmaximum [27]3 years ago
3 0

Answer:

d. visceral.

Explanation:

The visceral reflex is one that happens autonomously in the body, aiming to maintain the balance of the body through quick responses to some specific impulses. An example of a visceral reflex is the reduction in body temperature with the release of sweat from the sweat glands.

The visceral reflexes are controlled by the autonomic nervous system, using the sympathetic and parasympathetic nervous system.

You might be interested in
Which part of a sperm cell is responsible for housing the genetic information
babymother [125]
The head at the top, the tail is just for getting to the egg
8 0
3 years ago
Blood has a lower concentration of hydrogen ions than cellular cytoplasm. What does that tell us about the pH?
Greeley [361]

Answer:Acids and bases In the human body, both blood and the cytosol (watery goo) inside of cells have pH values close to neutral. ... A base, in contrast, raises pH by providing hydroxide (OH −start superscript, minus, end superscript) or another ion or molecule that scoops up hydrogen ions and removes them from solution.

Explanation:

8 0
2 years ago
A slower-than-normal heart rate is called A slower-than-normal heart rate is called tachycardia. premature contractions. bradyca
stealth61 [152]

Answer: it is called Bradycardia.

Explanation:

Bradycardia is a slower that normal heart rate. The heart rate of adult human usually beats between 60 to 100 per minutes . A testing heart rate less than 60 beats per minutes is called Bradycardia with the exception of Adult in deep sleep. It could be a serious problem if the heart could not pump oxygen rich blood to the body. It is caused by damaged of heart tissues from heart disease or due to aging. Heart disorder from birth or infection of heart tissue

7 0
3 years ago
What kind of water is found in the benthic zone of a lake?
Amiraneli [1.4K]

Answer: D

Explanation:

7 0
3 years ago
Given the sequence ATGGCGAATCACGTCACTTGA
Marina86 [1]

Answer:

a. TACG

b.UAC CGC UUA GUG CAG UGA ACU

c.ATCG

d.ser-arg-leu-val-ser-stop-thr

Explanation:

4 0
3 years ago
Other questions:
  • A new father tells the nurse that he is anxious about not feeling like a father. what is the priority nursing action to meet thi
    13·1 answer
  • Explain how the wound healed itself over by putting to in order please??????
    11·1 answer
  • Dan and Fiona have decided to utilize technology to overcome their infertility problems. They opt for a procedure in which a mat
    11·1 answer
  • ????¿???????????????????????
    6·1 answer
  • Describe and explain the importance of the change to corn
    9·2 answers
  • A structure made up of two or more kinds of tissues that perform a special function is an
    12·1 answer
  • Graves disease include what its symptoms are, who it can affect most, what other issues it can cause, and what medications or ch
    14·1 answer
  • Explain how fossil evidence and transitional fossils supports the idea that organisms change over time. Choose all that apply.
    15·2 answers
  • Which is an abiotic factor that can be found in a rain forest ecosystem?
    6·1 answer
  • What is the mass of the green cone on gizmos
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!