1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sholpan [36]
3 years ago
9

The specialized tissue in the root that functions in food storage is the

Biology
1 answer:
AfilCa [17]3 years ago
7 0
Straightforward, dependable core facility HLA tissue typing service

Using state of the art genotyping technologies as used in HLA typing for organ transplantation

We work with genomic DNA, Saliva, Whole Blood, or Cryopreserved cells

Detailed results typically sent in 3 weeks



typeHLA Tissue Typing Service Overview


Typing technology options
New Next Generation Sequencing (NGS)
PCR-SSOP using Luminex®
(previously called Tier 1)
HLA Class I loci available
A, B and C
(whole Class I panel reported)
A, B, C
(can be ordered individually)
HLA Class II loci available
DRB1, DPB1 and DQB1
(whole Class II panel reported)
DRB1, DRB3,4,5, DPA1*, DPB1, DQA1*, DQB1
(can be ordered individually)
Resolution of typing data

Fully resolved 4 digit (allelic level) typing with no degeneracy for all samples


4 digit (allelic level) typing but with some degeneracy

Features / Restrictions

Only available for ordering whole Class I panel (3 loci) or whole Cass II panel (3 loci) or whole Class I and Class II panel (6 loci)

Can be ordered for each locus individually

Turnaround time (approximate)
3 weeks
Sample formats accepted
gDNA, Cryopreserved PBMCs/other Cells, Blood, Saliva
Report format
Electronic format (PDF, XLS) via secure webserver
You might be interested in
Describe how water’s unique properties helps a polar bear to survive. Include each of the properties of water and how each of th
KonstantinChe [14]

the very basic properties of water

conducts heat

neutral pH

high surface tension

high specific heat

good solvent

how does this help a polar bear, some of it is a stretch but possible benefits

pH - good drinking water, good for marine ecosystem for food

high specific heat - can absorb lots of heat before the temperature rises, polar bears exist naturally in cold environments. (ice) - maybe can tie this in with the natural hibernation cycle

high surface tension - I'm assuming the polar bear walks on the ice at times to get fish

as a good solvent - its probably good that most things dissolve in water, otherwise we would have a lot of floating gunk on top of the water

outside of this, can't give you much more. it has been noted in Shishmaref Village that the ice caps melting is leading to a lack of water in higher mountain areas and polar bears are coming down from the mountain ice cap areas to find food and water

3 0
3 years ago
Is it possible for a man and a woman, each with Type A blood, to have a child that is Type O?
miss Akunina [59]

Answer:

yes

Explanation:

Even though both parents still have blood type A, Dad can pass on either his A or his O gene version. Mom can also either pass on her A or her O. Because of this, you can see that there's 1 in 4 or 25% chance for a child to have  blood type O.

3 0
3 years ago
Match the situation to the correct transport described.
san4es73 [151]
1. C
2. E
3. A 
4. B
5. D
7 0
3 years ago
Which of the following statements stated below is precisely correct?
Crank
Both a b c are the right answer choice for this question
6 0
3 years ago
Why are enzymes so important?
Inessa [10]
A, because they acts as catalysts in the chemical reactions crucial for life within organisms
3 0
4 years ago
Other questions:
  • Amoebas are unicellular organisms, while human beings are multi-cellular and the most intelligent of organisms. However, both ar
    15·2 answers
  • In a step by step format, write about the process of the blood flow as it enters the heart until it leaves the heart. It should
    12·2 answers
  • Child has blood types b, rh–, and m. his mother has blood types o, rh+, and mn. give the genotype of the mother, and the possibl
    9·1 answer
  • A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
    14·1 answer
  • Write an expression that shows how to multiply 4x365 using place value and expanded form
    13·1 answer
  • The energy that is used by almost all living things on our planet comes from the sun. it is captured by plants, algae, and some
    7·1 answer
  • PLEASE HELP!!! 50 POINTS!
    7·2 answers
  • Why does the lake need to be older than the canyon for the spillover theory to work?
    8·1 answer
  • Plants will grow best with ____ light.
    5·1 answer
  • You are knowledgeable about cellular metabolism. Which of the following processes is common to fermentation, anaerobic respirati
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!