1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elena-2011 [213]
3 years ago
5

Which statement is true about fossils?

Biology
1 answer:
exis [7]3 years ago
8 0
Fossils take several hundred thousand years to form and it is rare to find a fossil of skin (skin is usually eaten or rotted away in the first decade, so it rarely turns into a fossil).
You might be interested in
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
You are called for a​ 2-year-old boy who fell and cut his arm. while en route to the​ call, the dispatcher informs you that the
ICE Princess25 [194]
If a patient has hemophilia and has cut themselves, you need to realize that the bleeding may not stop for the entire transport and manual pressure may needed to be applied the entire time. You should start an IV on the patient and administer saline, depending on the amount of blood loss.
3 0
3 years ago
As a scientist, you seek to prove that DNA is the hereditary macromolecule by replicating the Hershey-Chase experiment. You cult
weeeeeb [17]

Answer:

The correct answer is option e. "None of the above".

Explanation:

The Hershey-Chase experiment helped to prove that DNA was the genetic material, by specifically labeling the DNA material of a bacteriophage with phosphorus-32. In this experiment the lambda phage is labeled with heavy and light Cl. CI-36, the one that is heavy and radioactive, corresponds to Chlorine-36. Chlorine is not an element found in DNA such as phosphorus, therefore lambda DNA will not be labeled and no radioactivity will be detected.

6 0
3 years ago
Help me with the answers please
jeka94
I’m going to say for the first one it’s a
5 0
3 years ago
Some fungi are unicellular organisms which feed off human tissues making a person ill. How do these fungi compare with bacteria
RUDIKE [14]

Answer:

Fungi are unicellular organisms  eukaryotic organisms that includes microorganisms such as mushrooms, yeast, and molds.

Bacteria are group of  single-cell microorganisms present in different shapes such as spirals, rods or spheres.

<em>Some of the fungi can causes disease and infection to humans same as bacteria.</em>

Fungi infects humans primarily through their skin. As fungi reproduce through spore formation often present in the air and soil and come in contact with human body surface which further multiply at body surface and infects human. Some of the fungal infections include ringworm,  athlete's foot and jock itch.

Same as Fungi bacteria also enters into human body and multiply within the human cell causing human diseases such as tuberculosis, typhoid fever and cholera.

7 0
3 years ago
Other questions:
  • Which landform represents a large area of flat or gently rolling land? A. Delta B. Dune C. Plain D. Plateau
    14·2 answers
  • Similarities and differences between prokaryotic cells and eukaryotic cells
    9·2 answers
  • 1) What are the two parts of the nervous system?
    7·1 answer
  • Which shows the levels of organizational hierarchy listed from least complex to most complex?
    15·2 answers
  • What is a variation for a shark
    7·1 answer
  • cA cell in G1 of interphase has 12 chromosomes. How many chromosomes and DNA molecules will be found per cell when this original
    8·1 answer
  • Where is the chromatin located?
    8·1 answer
  • What is micro organism
    15·2 answers
  • How does the electron transport chain use the high-energy electrons from glycolysis and
    9·1 answer
  • 20
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!