1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mezya [45]
3 years ago
12

BIG POINTS To whoever answers this 50 POINTS ok Describe how energy is produced from power of water. In your answer, include the

terms : ocean water,turbine, electricity and enviroment. You may also include the turms currents , waves , and tides. Use 3-5 sentences and proper conventions(spelling, grammer, punctuation, etc.) to respond. put all answers in your own words
PLZ HELP
Biology
1 answer:
ioda3 years ago
4 0

Hydropower can be harnessed from flowing and falling water. Water stored behind dams and at a height has a lot of potential energy which is converted into mechanical and electrical energy.This water is released gradually and is made to fall under the force of gravity and drive hydraulic turbines and electri­cal generators. Hydropower is also another indirect form of using solar energy. Hydropower has great potential as a supplier of electricity but environmental constraints limit such a development as the generation of electricity by hydro­electric power plants result in pollution and massive ecological disruptions such as land flooding, siltation, eutrophication and adverse effects on flora and fauna. Smaller dams and reservoirs cause less damage but cannot exploit the full potential of this energy resource. Planning environmental impact assessment and construction of a hydroelec­tric power plant takes many years and the high initial capital investments are also limiting factors in the development of hydropower. The development cost of hydroelectric power plants can be reduced by developing low cost turbines and generators, involving public participation in the development and opera­tion of the project and using efficient environmental friendly technologies.

You might be interested in
What is the role of phospholipids and proteins in controlling the passage of substances across the cell surface membrane, making
Anastaziya [24]
Phospholipids are the substance/structure that is the building block of the cell membrane. Without phospholipids, we wouldn't even have a cell membrane and wouldn't really have any way how to shield and guard or control th epassage of substances across the cell surface. The cell membrane is at the same time partially permeable; this means it will let certain ions that can be found in the intra and extracellular fluid in and out, while others will be kept from moving so freely. 
8 0
3 years ago
Genetic codes contain _____.
denis23 [38]
<em>Genetic codes contains <u>ORGANISMS.</u></em>
6 0
3 years ago
Read 2 more answers
Breathing is related to the carbon cycle because
Katarina [22]

Answer:

In animals, oxygen combines with food in the cells to produce energy for daily activity and then gives off carbon. The carbon combines with oxygen to form carbon dioxide (CO2) and is released back into the atmosphere as a waste product when animals breathe and exhale.

8 0
2 years ago
I also need help with dis plz?
Evgesh-ka [11]
Your answer would be the first one “prophase”
Explanation - prophase
During prophase, the complex of DNA and proteins contained in the nucleus, known as chromatin, condenses. The chromatin coils and becomes increasingly compact, resulting in the formation of visible chromosomes. Chromosomes are made of a single piece of DNA that is highly organized.
3 0
2 years ago
Read 2 more answers
when a person is making cardiovascular gains through aerobic activity they are in creasing the amount of to their heart and lung
evablogger [386]
Capacity and overall strength of their lungs and heart.
4 0
3 years ago
Other questions:
  • What does natural selection favor?​
    11·1 answer
  • WILL MARK AS BRAINLIEST
    6·1 answer
  • Which is the first vertebea that the spinal cord pass through ?
    7·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • Membrane lipids in tissue samples obtained from different parts of the leg of a reindeer have different fatty acid compositions.
    11·1 answer
  • Infiltration is the process that helps to add water to the Earth's
    15·1 answer
  • Diagram of internal structure of nose​
    11·1 answer
  • What are the 2 stages of photosynthesis
    15·2 answers
  • Help me please, I'm dying here
    10·1 answer
  • What is an atomic mass of an atom referring to?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!