Answer:
a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\
b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d.The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
Very detailed and over documentation of what they were doing, their results, the outputs. And noting on everything that was going on and who was there as well.
Well advance in technology is always good. The advancement helps so that information can be gathered quickly.Also it helps to understand things better. like before telescopes or microscopes scientist could only eyeball things but later the advancement made it easy to see things human eyes cant see.
i hope this is good
