1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alex41 [277]
3 years ago
13

NEED HELP ON NUMBER 3

Biology
1 answer:
finlep [7]3 years ago
8 0

If the animals didnt exist in the forest the forest wouldn't exist so that's why when an animal goes extinct it affects the ecosystem dramatically

You might be interested in
_______dispose of solid biodegradable wastes through the implementation of the process of decomposition.
Natalka [10]
The appropriate response is compost piles. It is a heap of substituting layers of plant garbage and soil regularly with an admixture of creature excrement or compound manure masterminded so a to energize the quick change of the constituents into fertilizer.
4 0
4 years ago
Read 2 more answers
Read the paragraph below and explain how this scenario could have happened:
ale4655 [162]

Answer:

<em>This phenomenon occurred due to natural selection and evolution.</em>

Explanation:

Natural selection tends to favour organisms carrying the alleles which provide better traits to live in an environment. Evolution tends to change the allele frequency of a species with time depending on the adaptations which are more perfect to survive in an environment.

In the past, blue frogs lived in lakes. The colour of the lake matched with the colour of the frogs. As a result, these frogs could escape from their predators and hence were better adapted to survive in such an environment.

When the lake dried, the blue frogs were not adapted to live in the muddy environment as their colour no longer helped them to escape from the predators. As a result, natural selection favoured those organisms carrying brown colour and evolution changed the allele frequencies and increased the number of brown frogs.

7 0
3 years ago
Executive functioning has been linked to development of the brain's _____ area. cerebellum prefrontal cortex midbrain hindbrain
lapo4ka [179]
Executive function are cognitive skills that help you control your thoughts into actions, as well as your emotions. Specifically, it includes mental skills such as attention to tasks at hand, time management, multi-tasking, and other mental processes that help you decide on how you behave in front of others. The part of the brain that handles this information is the pre-fontal lobe.
5 0
4 years ago
Animals are associated with_____, and plants are associated with_____. (Fill in the blank)
olasank [31]
I believe it is a, but I am not sure.

Sorry if I am wrong
8 0
3 years ago
Read 2 more answers
* earth science <br> MULTIPLE CHOICE<br> As Keisha heats up water for hot chocolate, the molecules
klasskru [66]

Answer:

the molecules expand

Explanation:

When water is heated, it expands, or increases in volume. When water increases in volume, it becomes less

3 0
3 years ago
Other questions:
  • Evolution _____.
    14·2 answers
  • Which answer best explains why the townshend acts were passed
    11·1 answer
  • How to calculate your average grade in one class?
    13·1 answer
  • The only force that can act on an object in freefall is what?
    13·2 answers
  • For this question, look at the hydrologic cycle diagram.
    8·2 answers
  • Maintaining internal conditions within in an organism is a characteristic of life known as _____.
    12·2 answers
  • What gas is used? _____ released?_______
    10·1 answer
  • . How many Å are in a meter?
    6·2 answers
  • Halogens are destructive to ozone because they are highly reactive with oxygen.
    14·2 answers
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!