Im gonna answer the ones i stufied in grade5 and back soo question 2 a food web question 4 they break down dead and decaying organic material question7 omnivores
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Active transport. Which the molecules are transported by a protein called carrier protein with the help of ATP.
I would say B) <span>The shoot is positively phototropic and negatively gravitropic; the root is positively gravitropic and negatively phototropic.
This is because the shoot of the plant is attracted towards the sun, as the chloroplasts in the leaves need sunlight to make food. As well, the roots are attracted downward to absorb more water and minerals from the sun.
</span>
Answer:
True
Explanation:
It can rapidly increase if the environment is good for them
