1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tatuchka [14]
3 years ago
9

During cell division, genetic material is contained in structures called

Biology
1 answer:
777dan777 [17]3 years ago
3 0

The right answer is D-chromosomes.

Chromosomes are visible only at the time of cell divisions (mitosis or meiosis). They essentially contain the molecules of A.D.N. carriers of genetic information and proteins such as histones that maintain the structure of chromosomes.

Each species contains a number of chromosomes of its own. In most sexually reproducing species, non-sexual cells (somatic cells) possess duplicate chromosomes, one of which is derived from the male gamete and the other from the female gamete. These species, individuals or cells are called diploids. Gametes that contain only one chromosome of each pair are called haploid.

You might be interested in
Each cell has a structure that separates the inside of the cell from.the environment. What cell is this?
kotykmax [81]

Answer:

Either the cell wall or the cell membrane.

Explanation:

All cells have cell membranes which line the outside of the cell, and some cells have cell walls, which also line the outside of the cell. Since all cells have cell membranes I am inclined to believe that the correct answer would be cell membranes.

8 0
3 years ago
TU PULS
lina2011 [118]

Answer:

To make sure that the experiment is accurate, the scientist must make carry out an appropriate observation, which would lead to the formation of good hypothesis. Good experimental method is an other criteria to look forward for the accurate experimental results. Methods are applied in collection of data and other things and in compiling results using statistical methods to carry out an accurate experiment.

3 0
3 years ago
_____ can disrupt cellular homeostasis and can even lead to uncontrolled cell division and form of cancers
Gekata [30.6K]
The correct answer would be carcinogens. Carcinogens can disrupt cellular homeostasis and can even lead to uncontrolled cell division and form of cancers. These are substances that damages the cellular metabolic processes in the body. Carcinogens are found everywhere; it may be in our food, radiation or even some of the ingredients of the things we use daily. 
6 0
3 years ago
Heyy heyyy jeyyyyy heyyyyy heyyyyy heyyyyy heyyyyy heyyyy
musickatia [10]

Answer:

Heeyyyy

Explanation:

HEYYYYY

6 0
2 years ago
Describe how sandstone, a sedimentary rock, may become a metamorphic rock. Enter your answer in the space provided. HELP 30 POIN
pshichka [43]

Explanation:

When sandstone is overlaid by layers and layers of sediment, it becomes subject to enormous pressure and temperature beneath the layers and its grain structure begins to change. The force of compactness causes grain structure and size to reform. This is called metamophism., The sandstone becomes a new rock called quartzite.  The two rocks will have different properties. Quartzite will have larger crystals and will be hard and smooth while sandstone will be coarse and soft.

Learn More:

For more on metamorphic rocks check out;

brainly.com/question/7669545

brainly.com/question/11972003

#LearnWithBrainly

7 0
3 years ago
Other questions:
  • Picture of Eukaryotic cell
    14·1 answer
  • How do you drop a raw egg onto a concrete floor without it cracking?
    7·1 answer
  • Her immune system is exhibiting the _ line of defense. This defense is part of _ immunity.
    7·1 answer
  • The study of energy and its changing forms is called _____.
    11·1 answer
  • Which of the following is an accurate description of an adult stem cell?
    13·2 answers
  • 4. Which is not a function of the cytoskeleton?
    14·1 answer
  • If the DNA of a representative species from each of the major kingdoms was examined, the sequences coding for which of following
    10·1 answer
  • What is shown in the photograph below?<br>©Coara DelorealbdTI.<br>​
    5·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • What is ONE major difference in the problems associated with obtaining measurements on the sizes or densities of animal populati
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!