1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ziro4ka [17]
4 years ago
12

The intermediate disturbance hypothesis predicts that species diversity will be ______when the frequency and/or intensity of dis

turbances are intermediate. A. lowest B. at intermediate levels C. highest D. none of the above
Biology
1 answer:
alukav5142 [94]4 years ago
5 0

The intermediate disturbance hypothesis predicts that species diversity will be highest  when the frequency and/or intensity of disturbances are intermediate

Explanation:

The diversity of the species is maximised at an intermediate near of anthropogenic as well as natural disturbances. As the competitively inferior disturbances are being tolerated for species disturbance and are termed to be dominant. Co exist of the sensitive species when the disturbance are either frequent or rare, which possess the reduced level of the disturbances. the productivity is predicted as very less due to competitive exclusion. As the disturbances increases productivity becomes less as most of them unable to sustain the regular destructive occurrence. So with the intermediate disturbances productivity is high as the rapid colonizers and dominant competitors are able to coexist.

You might be interested in
Why is rna necessary to act as a messenger? why cant the code be taken directly from the dna
Nitella [24]

Because there's one copy of the gene in DNA (2 for diploid species including humans). It would take a LONG time to make an appreciable amount of protein from two copies of the gene. But the cell can make many copies of mRNA to quickly make larger amounts of the desired protein.

6 0
3 years ago
Describe how the environment (predation, shelter, wind, access to water) might affect a population/ species?
Ira Lisetskai [31]
The answer is environment is the us
5 0
3 years ago
A student is given a small amount of unknown tan-colored liquid substance. This unknown liquid is placed into a glass of water a
amm1812
This liquid substance most probably be a member of the group of lipids. Liquids which do not dissolve in water are called hydrophobic substances. Nonpolar substances exhibit this effect. Lipids are a class of large molecules or macromolecules which are hydrophobic. Lipids include cholesterol, fat, and phospholipids. 
4 0
3 years ago
Read 2 more answers
In pea plants, the allele for inflated pod seed, I, is dominant over the allele for constricted pod seed, i. The Punnett square
zubka84 [21]

Answer:

<em>The offspring which carries the allele II will be homozygous dominant.</em>

Explanation:

A dominant trait can be described as a trait which masks the effect of a recessive trait. A recessive trait can be described as a trait which gets masked by the dominant trait.

A homozygous dominant trait occurs when both the alleles for the gen are dominant. A heterozygous dominant trait occurs when one allele is dominant and the other is recessive for the trait.  

Hence, a homozygous dominant trait will carry the alleles II.

8 0
4 years ago
PLLLZ HELP!!!Which of the two largest cavities forms earliest in fetal development? Why do you think that cavity, and its conten
jenyasd209 [6]

Answer:

htrtr

Explanation:

cvbnm,trt

7 0
2 years ago
Other questions:
  • What percentage of animals are vertebrates?
    11·2 answers
  • Substances that enter or leave the cell must pass through
    15·2 answers
  • How is the path of a bullet determined?
    14·2 answers
  • What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatct
    7·1 answer
  • 3. The half-life of carbon-14
    14·1 answer
  • Summarize the four steps to natural selection
    7·1 answer
  • Por que algumas mutações são mais prejudiciais do que outras
    8·1 answer
  • Severe acute respiratory syndrome (SARS) is an illness caused by a coronavirus. Symptoms include a high fever, headaches, and bo
    14·2 answers
  • Taste and smell are similar because they:
    14·2 answers
  • Rainforest deforestation is contributing to _______. A. A decline in global biodiversity b. The reduction of greenhouse gases c.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!