These steps are characteristic of a diplontic life cycle, in which haploid gametes are produced.
<span>Ni = 5
The Rydberg formula for hydrogen is
1/w = R(1/a^2 - 1/b^2)
where
w = wavelength in vacuum
R = Rydberg constant 1.0973731568508x10^7 1/m
a,b = integers greater than or equal to 1 and a < b
Now we need to select the value for a.
a = 1 will converge towards 91.13 nm
a = 2 converges towards 364.51 nm
a = 3 converges towards 820.14 nm
...
Because of this, we will assume a = 1 for this problem since it converges closest to the wavelength given.
Substitute known values
1/w = R(1/a^2 - 1/b^2)
1/9.504x10^-8 = 1.0973731568508x10^7(1/1^2 - 1/b^2)
10521885.52 = 1.0973731568508x10^7(1/1 - 1/b^2)
0.958824759 = 1 - 1/b^2
-0.041175241 = -1/b^2
0.041175241 = 1/b^2
24.28643927 = b^2
4.928127359 = b
So Ni = 5.</span>
Answer:
There are two types of vesicle transport, endocytosis and exocytosis (illustrated in the Figure below). Both processes are active transport processes, requiring energy. Illustration of the two types of vesicle transport, exocytosis and endocytosis.
Explanation:
So in a simple explanation yes they require energy:)
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
