Nicki is the queen of rap ok iwgdowgos yes owvdodbi wish isgdow owgbhh soften sostén i when is he i ishiev is he osteoblasts
Answer:
D. Smoke from a fire
Explanation:
Smoke from a fire is the correct answer because it is made up of physical atoms. Sounds, light, and temperature are not made of atoms and are thus not matter.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
<span>the young of a viviparous animal, especially of a mammal, in the early stages of development within the womb, in humans up to the end of the second month.
</span>
