1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Grace [21]
4 years ago
15

Metabolic pathways can be controlled through the availability of enzymes and modulation of their catalytic activities. Enzyme av

ailability can be regulated via _______, while enzyme activity is commonly regulated via _______.
Biology
1 answer:
postnew [5]4 years ago
8 0

Answer: a) substrate and cofactors b) covalent modification

Explanation:

Metabolic pathways involve all the chemical processes takes place in the enviornment or in an organisms.The metabolic pathways are controlled through the catalytic activities of enzymes.

The availability of enzyme is regulated  by substrate and cofactors present in enzyme and enzyme activity is commonly regulated via covalent modification.

Enzymes are highly selective in nature and bind to a specific substarte only. The active site in enzyme binds with the substrate to form enzyme substrate complex. Coactors assist the enzyme activity, without cofactor enzyme can not perform its activity.

Hence enzyme availibility is regulated by  substrate and cofactors regulates.

Covalent modifications regulates activity of enzyme as it involves addition and removal of chemical group to synthesis required protein. It can change the chemical properties of the site by targeting one or multiple amino acid.

Thus the correct answer is a) substrate and cofactors b) covalent modification

You might be interested in
What materials formed the solar system?
Brrunno [24]
According to this theory, the Sun and all the planets of our Solar System began as a giant cloud of molecular gas and dust<span>.</span>
7 0
3 years ago
Read 2 more answers
What do anaerobic photosynthesizing bacteria from early Earth have in common with all organisms today?
miskamm [114]
The answer is :they passed on their genetic material to new cells when they reproduced.
Explanation : Well when cells undergo division , they pass on their genetic material , so that's the same way that bacteria passed and still passes it's genetic material by the process of rep
roduction.
Hope this helps :)








5 0
4 years ago
Read 2 more answers
Can someone plz help me? :(
elena-s [515]

Answer:

your answers are gonna be a,c and d

Explanation:

6 0
3 years ago
Read 2 more answers
A drug decreases heart rate by blocking a receptor on cardiac muscle cells. this drug probably binds to:
jolli1 [7]
Njfhuj gjjff yuku unkind hkkr ikhrb
7 0
3 years ago
The study of anatomy is divided into two fields, gross anatomy and microscopic anatomy. Which of the following scenarios involve
tatuchka [14]
Human anatomy deals with the study of the human body, its structures, and how these structures specifically function. Microscopic anatomy on the other hand deals with structures found within the body that cannot be seen by the naked eye but can be viewed with the use of the microscopic. Microscopic anatomy deals with the study of the smallest structures of the cells, tissues, and organs of the body.
7 0
4 years ago
Other questions:
  • Anesthesia reimbursement a needle biopsy, lasting 15 minutes, was performed in portland, or, on a 75-year-old patient. the basic
    5·1 answer
  • What nuclear and cytoplasmic changes would you expect to find in cancer cells, as compared to their normal counterparts? (HINT:
    12·2 answers
  • How does nuclear fusion energy reach earth
    13·1 answer
  • Scientists estimate that by the year 2025 the worlds population will reach
    10·1 answer
  • How do humans change the composition of the Earth’s Atmosphere? (CITE 3 EXAMPLES)
    6·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Complete this sentence to create an argumentative claim .
    12·1 answer
  • Which level of organization does the phrase below belong to? The air was cloudy as the birds and geese migrated south. They stop
    6·1 answer
  • What specific type of tissue makes up the intervertebral discs
    6·2 answers
  • Which documents have phi on them. select all that apply: a. student brain/report sheet c. nor d. assignment sheet
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!