1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Darya [45]
2 years ago
5

During an experiment, readings for blood pressure in a person’s body were found to be constant. However, when measured by a diff

erent blood pressure cuff, the readings differed by 15 points for each reading. This difference indicates that the results are
Biology
1 answer:
Lemur [1.5K]2 years ago
6 0

Answer: Most likely means that the results are inconclusive or that the second blood pressure cuff is faulty.

You might be interested in
Which organelle recycles molecules for the cell to use again?
Sphinxa [80]

Answer:

lysosomes

Many components of the cell eventually wear out and need to be broken down and the parts recycled. This activity takes place inside the cell in specialized compartments called lysosomes.

3 0
3 years ago
Some geneticists study the genes that control bone development to try to understand bone growth and find cures for diseases. How
AnnZ [28]

Options:

a) the geneticist looks at the symptoms of a disease, and the orthopedist does not.

b) the geneticist works in a hospital, and the orthopedist works in a lab.

c) the geneticist focuses on what causes the disease, and the orthopedist treats the disease.

d) the geneticist deals with patients, and the orthopedist does not.

Answer:

The geneticist focuses on what causes the disease, and the orthopedist treats the disease. so thats why different from an orthopedist (a doctor who specializes in bones). Thus, the correct option is C.

<h3>What is chromosomes?</h3>

A chromosome is a lengthy DNA molecule that contains all or a portion of an organism's genetic code. Histones, which serve as packing proteins for the majority of eukaryotic chromosomes, work with chaperone proteins to attach to and condense the DNA molecule in order to preserve the integrity of the molecule.

A medical geneticist specializes in using DNA tests and genetic data to identify, manage, or prevent chromosome problems, inherited genetic illnesses, and other genetically driven diseases and ailments.

Orthopedic physicians, often known as orthopedic surgeons, concentrate on assisting you with musculoskeletal problems. They are responsible for identifying and managing diseases that impact your musculoskeletal system.

For more information regarding chromosomes, visit:

brainly.com/question/11912112

#SPJ1

6 0
2 years ago
Easy biology question:
Aliun [14]

Answer:

Rough ER - modifying lipids

Explanation:

Rough ER does not modify lipids! Smooth ER does that! Hope this helps :)

4 0
2 years ago
All of the following are found only in plant cells except
andriy [413]

Answer:

There is no answer to that.

Explanation:

  • Chlorophyll is located in the chloroplast, and it is a crucial component in green plants for photosynthesis.
  • Cells walls are present in plant cells only.
  • Large central vacuoles are part of plant cells, too.

None of the options are correct.

8 0
3 years ago
All proteins have a primary structure. Fibrous and globular proteins have a secondary structure: α helix or β pleated. Globular
MAVERICK [17]
The answer for this question is A
7 0
3 years ago
Other questions:
  • Why are biologists concerned about ecosystem disruption? (EXTRA POINTS)
    5·1 answer
  • EXPLAIN the difference between qualitative and quantitative data. Give examples to support your responses.
    7·2 answers
  • What is the difference between ovarian and oestrous cycle ?
    15·1 answer
  • Viral DNA makes mRNA by the process of _____. Viral DNA makes mRNA by the process of _____. replication infection translation ly
    7·1 answer
  • The ancient Egyptians used the stars to _____.
    8·1 answer
  • What is the function of plants?
    13·1 answer
  • Tại sao khi chi bị đau một bộ phận nào đó trong có thể những ta vấn thấy toàn có thể bị ảnh hưởng ?
    5·1 answer
  • Which part of a plant helps transport water to the leaves and the flower?​
    7·2 answers
  • Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
    14·1 answer
  • Veins have valves which allow blood to flow only in one direction. Arteries do not have valves. Yet the blood flows in one direc
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!