1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mario62 [17]
3 years ago
8

Prokaryotes stain as Gram-positive or Gram-negative because of differences in the cell _______.

Biology
1 answer:
vekshin13 years ago
4 0

Answer:

wall

Explanation:

Hans Christian Gram, a Danish bacteriologist, studied and defined the technique for staining bacteria, the Gram stain, in 1884. On this occasion, he experimentally stained slides with smears (a roughly speaking "scratch" of a particular place on the body). or from a culture to be researched) with gentian violet and realized that if the bacteria in these smears once stained did not fade with alcohol, if they were previously treated with iodine.

Advancing and refining the method, he added other dyes called “counterstains” such as safranin and basic fuchsin. The bacteria contained in the smear can be classified as Gram positive (approximately purple) or Gram negative (approximately red), this will depend on the bacterial cell wall. If it is the structurally simple bacterial wall the staining will be positive, if it is structurally complex the staining will be negative.

Gram-negative bacteria have a thinner, less complex wall of polysaccharides, so they do not absorb the stain used in the test. Gram-positive bacteria, however, have a thicker and more complex wall of polysaccharides and therefore absorb staining.

You might be interested in
It is a collection of different organ systems that work together to bring about various life activities
AveGali [126]
Just as the organs in an organ system work together to accomplish their task, so the different organ systems also cooperate to keep the body running. For example, the respiratory system and the circulatory system work closely together to deliver oxygen to cells and to get rid of the carbon dioxide the cells produce.
5 0
3 years ago
How do tsunamis effect the atmosphere? How do the hydrosphere, biosphere and the atmosphere affect tsunamis?
baherus [9]
Tsunamis leave little water droplets in the air, the biosphere has groundwater, tumbling down, causing the hydrosphere to rise, biosphere be "fertilizing" the groundwater, and atmosphere by gases that help form the tsunami
6 0
3 years ago
What are the chances that their offspring will have sickle cell anemia?
vlabodo [156]

25% is the correct answer

8 0
3 years ago
Read 2 more answers
The Pew Oceans Commission suggests four calls to action. What are they?
Nostrana [21]

Answer:

Pew Welcomes Global Ocean Commission's Recommendations for High Seas Conservation. ... Convention on the Law of the Sea to restore ocean productivity; guard against irresponsible, inefficient, and wasteful exploitation; and allow for the creation of high seas marine protected areas.

8 0
3 years ago
Unicellular organisms can perform all of their own functions, including respiration, ingestion, digestion, excretion, and reprod
almond37 [142]
Answer would be True.
6 0
3 years ago
Other questions:
  • the structure and properties of the cell wall allow it to be selective and maintain homeostasis true or false
    14·1 answer
  • From what sources did water arrive in Earth’s atmosphere?
    9·1 answer
  • What is the answer ?
    6·2 answers
  • 3.
    10·2 answers
  • Please explain the difference between a frameshift mutation and a base substitution mutation.
    15·2 answers
  • Which term best describes the protist shown above?
    8·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • What is the role of rna polymerase in transcription?
    6·1 answer
  • Of what value are forests besides for wood? Is there a value to forests that is not a monetary value? How much is that value con
    15·2 answers
  • What structure is denoted by the number 5, and what is its function in the cell? Number 5 is pointing to the entire structure, n
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!