1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Stella [2.4K]
3 years ago
10

What’s the answer to this earth science question?

Biology
2 answers:
german3 years ago
8 0

Answer:

its 4

Explanation:

Fed [463]3 years ago
7 0
The answer would be 3

You might be interested in
What was the result when Morgan mated fruit flies with the genotype XrXr and XrY
pentagon [3]

The answer is C.All the females had red eyes and half the males had red eyes

the possible outcomes are X big R, X big and little R, X big R and Y, and X little r and Y

7 0
3 years ago
Read 2 more answers
(True or False) Circadian rhythms usually<br> every year<br> Pls help!!!
diamong [38]

Answer:

False. It occurs about every 24 hours.

Explanation:

A circadian rhythm is a natural, internal process that regulates the sleep-wake cycle and repeats roughly every 24 hours.

6 0
2 years ago
Read 2 more answers
A 24-year-old client is being seen in the emergency department because of a high fever and cannot move the right arm. during the
Flauer [41]
 The client may be suffering from a neuroleptic malignant syndrome (NMS) which is a reaction to his antipsychotic medication. NMS is rare but
life-threatening and is characterized by high fever, muscular rigidity(that's why he can't move his arm), altered mental status hyperthermia, and autonomic dysfunction.

Since is life-threatening, it requires immediate treatment.




8 0
3 years ago
Read 2 more answers
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
The pouplations of the two species increase and decrease based on the numbers of each species present. This relationship is an e
anyanavicka [17]

Answer:

It is Competition

4 0
3 years ago
Other questions:
  • which layer of earths atmosphere contains no water vapor, has the atmospheric pressure less than .1 atm, and has an air temperat
    14·1 answer
  • Which of the following functions is performed by a protein
    6·1 answer
  • A type of Algae grows on a sloth. What must be true for the algae and the sloth to have a commensal relationship?
    9·1 answer
  • Which location a b or c please help
    12·1 answer
  • Why do developed countries have lower growth rates than less-developed countries? higher birth rates lower death rates higher de
    7·1 answer
  • if a gas has a volume of 1L at a pressure of 270 kPa what volume will it have when the pressure is increased to 540 kPa. Assume
    13·1 answer
  • Help please! Need help!!
    5·1 answer
  • Why is it important for an organism to maintain homeostasis
    9·1 answer
  • Es el nombre que se le da a un cuerpo celeste dentro de su trayectoria
    15·1 answer
  • In _________, enzymes cut DNA into fragments, which are separated by size to form a pattern of bands.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!