1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
RideAnS [48]
4 years ago
10

Where does all energy for most organisms on earth come from?

Biology
2 answers:
Ede4ka [16]4 years ago
6 0
D. We are mostly depending on sunlight for energy.
zlopas [31]4 years ago
5 0

Answer:

The correct answer is option d. "sunlight".

Explanation:

The sunlight is the major source of energy for organisms on Earth. Producers, such as plants and algae, use energy directly from the sunlight by the process known as photosynthesis. Other organisms such as consumers, eat organisms that get their energy from sunlight. Basically, all organism use sunlight as their fountain of energy or they obtain their energy from an organism that uses it.

You might be interested in
Why was the evolution of cuticle so important during the evolution of land plants?
vovikov84 [41]
The outer coverings that are tough but, flexible provided protection to the land plants.
3 0
4 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
once a consumer gains nitrogen nutrients from animals or plants it recycles these nutrients back to each by
SSSSS [86.1K]

Answer:

Decomposers get nutrients and energy by breaking down dead organisms and animal wastes. Through this process, decomposers release nutrients, such as carbon and nitrogen, back into the environment. These nutrients are recycled back into the ecosystem so that the producers can use them

Explanation:

8 0
3 years ago
Read 2 more answers
The characteristics of the active site microenvironment of an enzyme can be largely independent of individual catalytic mechanis
Valentin [98]

Answer: (1) Providing an optimized orientation of the substrate.

(2) Decreasing the ∆G in reaction.

(3) Excluding excess water.

Explanation: The active sites of enzymes increase the rate of reaction because they decrease the activation energy of the reaction,and the physical microenvironment provides an optimal orientation of the substrate relative to reactive functional groups while excluding excess solvent,such as water.

Although some active sites may have amino acids that form salt bridges with the amino acids from a substrate,not all do, so this is not a generic strategy of active site microenvironments

*Gotten directly from Quizlet*

8 0
4 years ago
Which statement about potential energy is correct?
Free_Kalibri [48]

Answer:

With gravitational potential energy, the farther the object is from the ground, the greater the potential energy would be.

6 0
3 years ago
Read 2 more answers
Other questions:
  • PLEASE HELP! WILL GIVE BRAINLIEST!!!!!
    6·1 answer
  • Carbohydrates are an important type of
    8·1 answer
  • What describes all scavengers?<br><br> A. consumers<br> B. producer<br> C. herbivore<br> D. omnivore
    6·2 answers
  • Which of these is a statement of opinion?
    5·1 answer
  • Two heterozygous purple-stemmed plants are grown. Each parent has the genotype ANL/anl. Pollen from one of the plants is used to
    11·2 answers
  • Which is an example of a polygenic trait.
    11·2 answers
  • Carbon is found in all known forms of life.which statement best describes why carbon
    6·1 answer
  • Why do the chromosomes form a V shape facing the center of the cell during Anaphase
    14·1 answer
  • I am able to fill a glass of water to the top and it does not overflow…which property of water allows this to happen
    12·2 answers
  • Muscles that guard entrances and exits of internal passageways are ________ muscles.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!