2 years ago

Which relationship will increase a population's size

2 answers:

7 0

The answer is D because the more persons born, the more the population will increase. If the birthrate is higher than the deathrate, there will be more people.

AleksandrR [38]2 years ago

5 0

D because with more birthrate than deathrate the population will increase.

You might be interested in

Which is defined as a cell structure made of DNA that gives all of the master instructions for the cell?

Doss [256]

Answer:

a chromosome is a cell structure made of DNA,which is found in the nucleus of a cell.

I hope this helps

7 0

2 years ago

What features are formed along the divergent boundary?

avanturin [10]

rift valleys

mid oceanic ridges

8 0

2 years ago

If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix

Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0

2 years ago

Heredity is described as the passage of genetic instructions from one generation to

Alexandra [31]

Answer:

Answer: The Blue eye trait skipped a generation and so the girl got the trait with the two alleles (bb: for example)

Explanation:

3 0

2 years ago

Read 2 more answers

What is the procedure for genetic trantformation

Diano4ka-milaya [45]

Answer:

Translocation

Explanation:

7 0

2 years ago