1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Brilliant_brown [7]
2 years ago
10

Which of the following is an example of a species changing over time.

Biology
1 answer:
pickupchik [31]2 years ago
3 0
The examples of species changing over time are statements A, C, and D.

All these changes, such as new types of squash was developed in the garden. weeds evolution to resist chemicals, and the changes in butterflies wing pattern over the years is because of Mutation. Obviously, rabbit's ears are always bigger than mice and Giraffe's neck is always longer than the deer's. In genetics, mutation is the process of permanent alternation of the nucleotide sequence in DNAs.
You might be interested in
Write a short story describing the application of the system of classification of living creatures
Citrus2011 [14]
All living creatures are classified into systems and sub-systems based on their similar characteristics. They are divided from bigger groups into smaller groups based on the detail of their similarities i.e. how they look, move, reproduce and how they relate to each other. A practical way of understanding the classification of living organisms is that organisms are linked to other similar organisms via family trees. The classification of all living creatures includes at least four levels: order, families, genus and species.
3 0
2 years ago
What kinds of things might scientist measure in a mine or well???
faust18 [17]

Answer:

In wells Scientist measure dissolved oxygen, or DO (pronounced dee-oh).

3 0
3 years ago
Q6.7. During many epidemics, health-care professionals emphasize the importance of
Serga [27]

During many epidemics, <u>healthcare </u>professionals emphasize the importance of  community mitigation strategies, such as wearing masks, frequent hand-washing, and social  distancing because these strategies help <u>reduce </u><u>transmission </u><u>even when drug-based treatments and vaccines are  unavailable.</u>

It is of <u>vital </u>importance in cases of epidemics to implement strategies such as:

  • Hand-washing
  • Wearing masks
  • Social distancing

in order to better protect our communities and ourselves.

Frequent hand-washing serves to<u> eliminate the presence of a </u><u>pathogen</u> <u>from the surface of your hands</u>, reducing the risks that it will find entry into your organism or land on a surface with which others will come into contact. Should you or someone else contract the pathogen anyways, wearing a mask can help to reduce or deny the possibility of transmitting the disease.

Finally, should both previous measures fail, meaning that the virus or pathogen has infected an individual and penetrated the masks, social distancing can act as a <u>final barrier</u> that the pathogen will rarely be able to surpass, given that most pathogens <u>cannot remain airborne over large distances. </u>

For these reasons, healthcare professionals emphasize the importance of these strategies because they help reduce transmission <u>until vaccines or drug-based treatments become  available and </u><u>herd immunity </u><u>can be reached. </u>

To learn more visit:

brainly.com/question/17606451?referrer=searchResults

3 0
3 years ago
The diagram below shows a neuron, which has specialized structures at one end called dendrites. These structures receive signals
snow_lady [41]

Answer:

Its C

Explanation:

I got it right. Your welcome

6 0
2 years ago
What is Euroscience?
serious [3.7K]

Answer:

What is neuroscience---------------->any or all of the sciences, such as neurochemistry and experimental psychology, which deal with the structure or function of the nervous system and brain.

Explanation:

mark me brainliest pls

4 0
3 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Which of the following is an enzyme? lactose adenosine protease phosphate
    10·1 answer
  • Impaired and delayed healing in a person with diabetes is caused by chronic complications that include:
    15·1 answer
  • An ecologist observes that a population of plants in a meadow has flowers that may be red, yellow, white, pink, or purple. hypot
    14·1 answer
  • Which of the following processes is directly responsible for growth in living organisms ?
    6·2 answers
  • Does the bowing ball have more potential energy or kenetic energy as it’s half way through its fall? Why?
    6·1 answer
  • Examine the air pressure map. Which type of line is shown on the map?
    9·1 answer
  • How has selective breeding changed the wolf into the many different breeds of domestic dogs that we know today?
    8·2 answers
  • If all organisms originated in their present forms during a single event, Darwin wondered, why was there a distinctive clusterin
    14·1 answer
  • Hi hi hi hi hi hi hi hi hi hi hi hi hi hi<br> peeeeeeeeeeeeople dont know y i ask thut question
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!