Answer:
The level of the water in the pond would increase.
Explanation:
Answer:
Biosequestration is the capture and storage of the atmospheric greenhouse gas carbon dioxide by continual or enhanced biological processes.
Answer:
the answer is 53
Explanation:
step 1: Multiply -10 and -5 together that will give you 50.
( it is positive because whenever you multiply or divide 2 negatives together it becomes a positive.)
Step 2: Then add the +3 to the 50
Step 3: final answer equals 53.
Answer:
The two nucleotides are located on DNA strands that are parallel to each other
Explanation:
Deoxyribonucleic acid, commonly known as DNA, is one of the two types of nucleic acids. It is a molecule composed of a nitrogenous base, pentose sugar and a phosphate group. According to the information given in this question, Adenine is the last nucleotide at the 3' end of one strand of DNA. The following are factual about the nucleotide;
- Since DNA is a double-stranded molecule, the Adenine nucleotide will be base-paired with Thymine nucleotide (complementary base pairing) on the other DNA strand.
- Since complementary DNA strands are opposite to one another, this means that if the adenine has an unlinked 3' hydroxyl group, then the thymine must have an unlinked 5' phosphate group.
- Nucleotides in a DNA strand are joined to one another via a covalent bond called PHOSPHODIESTER BOND. Hence, the adenine and the thymine are each bonded to the previous nucleotide in the strand by a phosphodiester bond.
- In the complementary base pairing between two nucleotide bases, there are two hydrogen bonds between the adenine and thymine nitrogenous bases i.e. A=T.
- DNA strands that make up a molecule are complementary and opposite to one another, hence, they are said to be ANTIPARALLEL.
Answer:
AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG
Explanation:
this is the complementary strand for the mRNA.
A=U
C=G
G=C
T=A
this is the key for any mRNA strand.
;)
