1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pshichka [43]
3 years ago
15

Please helpppp.......

Biology
1 answer:
12345 [234]3 years ago
8 0
373.4 is the weight
You might be interested in
What will happen to the amount of food available as a pondwater ecosystem ages
Paraphin [41]

Answer:

The level of the water in the pond would increase.

Explanation:

3 0
3 years ago
What is biosequestration?
egoroff_w [7]

Answer:

Biosequestration is the capture and storage of the atmospheric greenhouse gas carbon dioxide by continual or enhanced biological processes.

8 0
3 years ago
How can I solve -10(-5)+3 someone give me an example:)
Dima020 [189]

Answer:

the answer is 53

Explanation:

step 1: Multiply -10 and -5 together that will give you 50.

( it is positive because whenever you multiply or divide 2 negatives together it becomes a positive.)

Step 2: Then add the +3 to the 50

Step 3: final answer equals 53.

3 0
4 years ago
Read 2 more answers
Adenine is the last nucleotide at the 3' end of one strand of DNA. It is base-paired with thymine on the other DNA strand. Which
Jlenok [28]

Answer:

The two nucleotides are located on DNA strands that are parallel to each other

Explanation:

Deoxyribonucleic acid, commonly known as DNA, is one of the two types of nucleic acids. It is a molecule composed of a nitrogenous base, pentose sugar and a phosphate group. According to the information given in this question, Adenine is the last nucleotide at the 3' end of one strand of DNA. The following are factual about the nucleotide;

- Since DNA is a double-stranded molecule, the Adenine nucleotide will be base-paired with Thymine nucleotide (complementary base pairing) on the other DNA strand.

- Since complementary DNA strands are opposite to one another, this means that if the adenine has an unlinked 3' hydroxyl group, then the thymine must have an unlinked 5' phosphate group.

- Nucleotides in a DNA strand are joined to one another via a covalent bond called PHOSPHODIESTER BOND. Hence, the adenine and the thymine are each bonded to the previous nucleotide in the strand by a phosphodiester bond.

- In the complementary base pairing between two nucleotide bases, there are two hydrogen bonds between the adenine and thymine nitrogenous bases i.e. A=T.

- DNA strands that make up a molecule are complementary and opposite to one another, hence, they are said to be ANTIPARALLEL.

7 0
3 years ago
transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
tino4ka555 [31]

Answer:

AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG

Explanation:

this is the complementary strand for the mRNA.

A=U

C=G

G=C

T=A

this is the key for any mRNA strand.

;)

3 0
3 years ago
Other questions:
  • What is glucose used for
    12·2 answers
  • A plate moves 200m in 10,000 years. what is the rate in cm/year
    10·1 answer
  • He proposed the first serious model of how traits are passed on from parent to offspring, through inheritance of acquired charac
    11·1 answer
  • The epidermis is the most superficial layer of the skin. It is composed of stratified squamous epithelium. Within the epidermis,
    11·1 answer
  • Which is a biotic factor
    15·2 answers
  • Which organelle appears as a stack of membranes?
    13·1 answer
  • Which best compares and contrasts red blood cells and white blood cells?O Both are produced in the red bone marrow. Red blood ce
    8·2 answers
  • What was the purpose of placing the drop of distilled water onto the slide before smearing the bacterial colony onto the slide?
    5·1 answer
  • Specialized structures that work together inside a cell are called __________. Choose the correct answer.
    9·1 answer
  • You observe two breeding female fish of the same species. One female lays 100 eggs and the other female lays 1,000 eggs. Which o
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!