1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dominik [7]
3 years ago
6

A scientist bred fruit flies in two separate containers with different food sources for many generations. When she put the fruit

flies from the two containers together again, she observed that the flies preferred mates raised on the same food. Which conclusion can the scientist draw?
A. Fruit flies mate randomly regardless of how they were bred.
B. Fruit flies can adapt to eating different food sources.
C. Fruit flies prefer the container where they were bred.
D. Fruit flies prefer mates adapted to the same food source.
Biology
2 answers:
Sophie [7]3 years ago
6 0
D. Fruit flies prefer mates adapted to the same food source.
xz_007 [3.2K]3 years ago
3 0

Answer: The correct answer is -

Option D.

Explanation:

As per the given information in the question, initially fruit flies were in two different containers having different food sources for several generations. Due to this, they got adapted to the specific food sources to which they were exposed. As a consequence, they started preferring mates that were adapted to the same food source.

Therefore, when fruit flies from the two containers were put together, Fruit flies preferred mates adapted to the same food source.

Thus, option D) is the right answer.

You might be interested in
What is the term for solid organic matter transported by wind, water, or glacial erosion?
Julli [10]
Sediment or sedimentation is the term used for solid organic matter transported by wind, water or glacial erosion. Usually, Sediment is formed by weathering or rock. In time, this sediments will be accumulated and formed in a place in which it will stay.
8 0
3 years ago
Search BrainPOP
bagirrra123 [75]
A hypothesis is uneducated guess guess, or A guess you make before not knowing anything about the topic. The theory is A educated guess . Siri you would already know information about the topic and then putting your input
4 0
3 years ago
Which of the following statements best describes the relationship between the themes of “place” and “human-environment interacti
Pavlova-9 [17]
I think the correct answer from the choices listed above is option A. The relationship between the themes of “place” and “human-environment interaction” is that the characteristics <span>of “place” include things like economic activity, architecture, and culture, all of which are human elements that alter or can be influenced by the environment. </span>
5 0
3 years ago
Read 2 more answers
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
An area where heated water rises through cracks in the ocean floor is called a hydrothermal vent.
Fynjy0 [20]

Answer:

T

Explanation:

True. Hydrothermal vents are basically underwater volcanos

6 0
3 years ago
Read 2 more answers
Other questions:
  • How does the water inside plants return to the atmosphere?
    6·2 answers
  • Two reasons why it is easy to harvest perlemoen
    10·1 answer
  • The diagram shows a simple lipid.
    12·1 answer
  • A 17-year-old student has experienced reversible, periodic attacks of chest tightness with coughing, wheezing, and hyperpnea. Sh
    14·1 answer
  • Enter the degree of the polynomial below.<br>6x6+9х3 + 3х2 - 4х10 - 9х5 – 5б<br>​
    8·2 answers
  • Which organisms develop gills from pharyngeal arches and later develop lungs to breathe on land? Frog Scallop Salamander Scorpio
    14·2 answers
  • Which letter indicates a region of high pressure in the diagram below?
    7·1 answer
  • List and briefly describe four components of innate immunity (include one barrier defense and three internal defenses)
    5·1 answer
  • Tiny opening in the leaf that allow carbon dioxide to enter are called
    15·2 answers
  • Where is a squall line located in regards to the warm and cold front?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!