Answer:
The correct answer is: d.a nonpolar side chain.
Explanation:
- Protein can be defined as one of the factors which determine the structure as well as the function of a cell.
- Proteins are composed of polymeric chains of polypeptides, which are made up of amino acid monomers linked to each other by peptide bonds.
- Amino acids can be broadly categorised into non-polar and polar based on the nature of the side chain.
- The non-polar amino acids possess hydrocarbon side-chains which are hydrophobic in nature, so they tend to avoid interaction with water molecules and usually remain in the protein interior. They are uncharged and cannot form any hydrogen bonds with water molecules.
- The polar amino acids possess charged or polar side-chains which are hydrophilic in nature, so they tend to undergo interaction with water molecules and usually remain on the protein surface. They can form hydrogen bonds with molecules of water.
- Beta sheets can be defined a secondary structure of the protein in which the polypeptide sequence forms horizontal strands which are linked to each other by loops. Each strand interact with each other by the formation of hydrogen bonds between the C=O group of one peptide (amide) bond in one strand with the N-H group of another peptide (amide) bond in another strand.
- Apart from these bonds, the non-polar side chains of each amino acid in one strand forms hydrophobic or Van der Waals interactions with the non-polar side chains of each amino acid in the other strand. The polar or charged side chains of the amino acids on each strand form either hydrogen bonds with water molecules or with oppositely charged side chains.
- In the given question, glycine and alanine are non-polar amino acids but serine is a polar amino acid. The side-chains of the non-polar amino acids will tend to face towards the interior of the beta sheet thereby forming hydrophobic interactions with each other, while the serine will tend to face the exterior of the beta sheet so that it can form hydrogen bonds with water molecules.
- As the number of non-polar amino acids is far more than polar amino acids so the effect of non-polar amino acids will prevail in the beta-sheet.
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
A)Patent
Patent fingerprints, on the other hand, can be made by blood, grease, ink, or dirt.
Answer:
The prefix pro- primarily means “forward” but can also mean “for.” Some words that the prefix pro- gave rise to are promise, pro, and promote. When you, for instance, make progress, you are stepping “forward,” whereas if you give the pros in an argument, you are speaking “for” something by stating its advantages.
Explanation:
Dog breeding is an example of Associative mating.
