1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mazyrski [523]
3 years ago
15

1. A measurement has two parts true or false.

Biology
1 answer:
kicyunya [14]3 years ago
5 0

Answer:

1. True

2. True

3. I am not sure what you mean?....

Explanation:

1. A measurement is a quantitative observation that consists of two parts: a number and a unit.

2. At this time, only three countries—Burma, Liberia, and the US—have not adopted the International System of Units (SI, or metric system) as their official system of weights and measures.

You might be interested in
Which type of fault is under compression
seraphim [82]
I believe that it is a reverse fault
3 0
3 years ago
Read 2 more answers
In Linnaeus's time, all life was divided into thich two kingdoms?
nydimaria [60]

Answer:

The answer is D. Animals and plants

8 0
3 years ago
What are the wavelike contractions of smooth muscle that move food down the esophagus called
stiks02 [169]

When you swallow food, it doesn't just drop down into your stomach. Muscles contract in a wave-like motion to move the food along through the esophagus. This muscle movement is called, peristalsis, or peristaltic waves. These peristaltic waves contract behind the food bolus pushing it along the digestive tract.

7 0
3 years ago
What is the tense of the underlined verb?
zalisa [80]
If the underlined verb is <em>will have been talking, </em>in the sentence Lillian will have been talking for two hours by the time she finishes her classical music lecture, then the correct answer is D. future perfect progressive.
A would be - will talk.
B would be - will have talked.
C would be - will be talking. 
7 0
3 years ago
What is one way that fish interact with a coral reef?
Ksivusya [100]

Fishes use the coral reef for shelter during the day as well as food.

<h3>Information related to coral reef</h3>

One way that fish interact with a coral reef is that fish hide within the coral. Coral reefs are an important resource for large-bodied fish in the Caribbean. They use the reef for shelter during the day.

Coral reefs are important ecosystems because coral reefs contain a great diversity of life. The color of coral depends on the type of polyp present. Coral polyps are tiny little animals that can live individually, or in large colonies that comprise a coral reef.

Great Barrier Reef is considered as the largest coral reef on Earth. Coastal land development, silt runoff, water pollution by humans, damage from scuba diving, boating, and fishing are the threats to the health of coral reef.

Learn more about coral here: brainly.com/question/1143432

6 0
2 years ago
Other questions:
  • The shape of the moleculeformed when carbon bonds to 4 atoms
    13·1 answer
  • What must happen to the liquid as it passes from the stomach to the small intestine for digestion?
    6·1 answer
  • Which hormone is produced mainly in the stomach and regulates secretions of gastric juice?
    14·2 answers
  • A small child gives a plastic frog a big push at the bottom of a slippery 2.0 meter long, 1.0 meter high ramp, starting it with
    7·1 answer
  • A dentist is interested in obtaining information about delinquent (past due) accounts. Since the practice opened 8 years ago, de
    12·2 answers
  • Why would researchers use a longitudinal design to study motor development
    11·1 answer
  • One technique used to check ecosystem health and biodiversity of an ecosystem is to monitor populations of native species and in
    14·1 answer
  • In which of the following would the cell cycle be shortest?
    9·2 answers
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • Help me PLEASEE!!! IT will mean alot
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!