1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dahasolnce [82]
3 years ago
5

What is the most common cause of mutations in DNA of cells?

Biology
1 answer:
Masteriza [31]3 years ago
3 0

Answer: When DNA is being copied for the Daughter cells

Explanation: There is a mistake when the DNA is being copied for the new daughter cells. When a cell divides, it must divide its DNA into 2 exact copies of the orginal DNA for the 2 new daughter cells. Sometimes the copy isn't correct and the cells mutates.

You might be interested in
The atomic number of carbon is six, which means that a carbon atom has six protons. Carbon has three naturally occurring isotope
Sati [7]
Idk tbh I just need to answer for I can get help
5 0
3 years ago
All parts of nonvascular plants must be near water because they have…
tiny-mole [99]

Answer:

B) Tiny roots.

Explanation:

:)

(:

:)

(:

Hope this helps!

<3

-Josh

brainliest if correct?

7 0
2 years ago
Why do liquids freezes and melts at the same time?
Galina-37 [17]
So to sum up, when matter is transitioning from solid to liquid (melting) or liquid to solid (freezing<span>), its </span>temperature<span> is fixed at the </span>melting/freezing<span> point, which is the </span><span>same temperature</span>
8 0
2 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
2 years ago
Where is the capsid found in a virus?
marysya [2.9K]
The capsid surrounds the virus and is composed of a finite number of protein subunits known as capsomeres, which usually associate with, or are found close to, the virion nucleic acid
8 0
2 years ago
Read 2 more answers
Other questions:
  • How might a theory relate to a model
    6·1 answer
  • What is the role of nucleotides in DNA structure?
    7·1 answer
  • When a new species originates from two or more individuals of a preexisting species, we call this?
    11·1 answer
  • Which characteristics are used to differentiate between the six kingdoms?
    13·1 answer
  • How does the contractile vacuole in a single-celled organism function to maintain homeostasis?
    8·2 answers
  • Human skin color varies widely around the world, and children do not always have the exact same coloring as their parents. Based
    11·1 answer
  • What events does the land pollution have ?? <br><br> 20 points
    11·1 answer
  • Flatworms can be cut in half, creating two new individuals, by _____.
    5·2 answers
  • What questions you would like to ask your teacher to know about the role of vaccine in prevention of harmful diseases ​
    7·1 answer
  • Select the correct answer from each drop-down menu.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!