1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
solniwko [45]
2 years ago
13

The physical, chemical, and biological laws that operate today also in geologic past. This statement relates to the principle of

?
Biology
1 answer:
alexgriva [62]2 years ago
6 0
Here is the answer that would best complete the given statement above. <span>The physical, chemical, and biological laws that operate today also in geologic past. This statement relates to the principle of </span>uniformitarianism. Hope this answers your question. Have a great day!
You might be interested in
Why can benedict's solution be used to distinguish between glucose and sucrose?
sattari [20]
C........................................................................................................
4 0
2 years ago
What system protects outer cover if that body
Softa [21]
Integumentary system I believe
4 0
2 years ago
Read 2 more answers
What is a conifer tree
Step2247 [10]

Conifer tree is the tree that the leaf is slender like needle, it is evergreen tree more, material is general softer, some contain colophony , reason calls soft material again, its grows in elevation 100 ~ 1500 meters commonly, have economy and ornamental value.Conifers appeared 280 million years ago before any other trees.Conifers are believed to be the oldest trees on earth。

3 0
2 years ago
Read 2 more answers
The ability to detect physical energy through our visual or touch systems
PIT_PIT [208]
Sensation

detection of physical energy by sense organs, which then send info to the brain
- Detection of stimuli by sense organs
- how info gets to our brain = detecting stimuli
- allows us to pick up the signals in our environment
- ex. vision- going through eye to visual cortex and smell - going through nose.







8 0
3 years ago
Which statement about vacuoles is true?
Mila [183]

Vacuoles are storage organelles that are found in both animal and plant cells. They store food or any other forms of nutrients, they also store waste products so as to protect the contamination of the cell environment. These waste products are sent out of the cell via vacuoles. In plants the vacuoles are larger than in animals. The vacuole provides plant nourishment in the scarcity of water in the external environment hence, prevents the wilting of plants.

4 0
3 years ago
Read 2 more answers
Other questions:
  • List one advantage ,disadvantages about sporulation and what kind of organisms do this ?
    14·1 answer
  • Where do the reactions of the electron transport chain occur?
    7·2 answers
  • Which of these is NOT an environmental effect of deforestation?
    11·1 answer
  • Hypothesis: Increasing water temperature had no effect on the fermentation rate of yeast. Experiment: Compared yeast in room-tem
    12·1 answer
  • The visible part of the ear has the ability to stretch significantly, and then recoil back to its original position. Which prote
    9·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • The clumping of red blood cells, which occurs when incompatible blood types are mixed, is an example of ________. Group of answe
    10·1 answer
  • And object is 20 cm from the lens. The image from 6.66667 cm from the length. What is the focal length of the lens? Use the thin
    15·1 answer
  • What process happens farther up the river to bring the sediments to the delta?
    12·2 answers
  • Why is the research on plant material mentioned in the article important to Rohit Karnik’s work on membranes?
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!