1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
PolarNik [594]
3 years ago
6

explain why it is good to sweat during/after a workout. What might happen if an athlete did not sweat?

Biology
1 answer:
bekas [8.4K]3 years ago
4 0
Your body releases sweat to help regulate its body temperature to prevent you from overheating
Sweating also helps your body to eliminate toxins, which supports proper immune function and helps prevent diseases related to toxic overload
Sweating may help kill viruses and bacteria that cannot survive in temperatures above 98.6 degrees Fahrenheit, as well as on the surface of your skin
You might be interested in
What is a round worm
KATRIN_1 [288]
<span>a nematode, especially a parasitic one found in the intestines of mammals.</span>
4 0
3 years ago
Read 2 more answers
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Why is it important for others to believe in science, and what are two good things science has done for people,animals , or the
Zanzabum

Answer:

why are these same questions its earth and people i think

6 0
2 years ago
Doctors finally understood why a child had difficulty sleeping. They discovered that she had a large tumor located in the part o
Fynjy0 [20]

Answer:

The correct answer is - Pons.

Explanation:

The pons is located t below the midbrain and below the midbrain. It is a group of nerves that function as a connection between the cerebrum and cerebellum.

It is related to the various functions of the body such as sleeping, respiration, swallowing, bladder control, hearing, and many more. These functions

4 0
2 years ago
Can planes fly in the mesosphere ? why or why not ?
Nikitich [7]

Answer:

No

Explanation:

It is because of the air it will crush it.

4 0
3 years ago
Read 2 more answers
Other questions:
  • 19
    15·1 answer
  • Insects are responsible for the destruction of a significant percentage of potential food harvests every year. Please select the
    7·2 answers
  • Energy to us in Biology is the ability to do what?​
    11·1 answer
  • The filtration membrane includes all except ________.
    14·1 answer
  • this type of connective tissue in the central nervous system is a star shaped cell that anchors small blood vessels to neurons
    6·1 answer
  • Which cranial nerve is responsible for the motor innervation of pharyngeal muscles and parotid salivary glands?
    12·2 answers
  • Why do researchers think that seals use visual cues to<br> navigate?
    9·1 answer
  • Which bird is best adapted to live in a watery environment?
    9·1 answer
  • A factory located near the top of a hill leaks chemicals into the groundwater. How could this leakage affect the groundwater at
    12·1 answer
  • Read this excerpt from We've Got a Job.
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!