1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rama09 [41]
3 years ago
11

Calculate the mass defect for oxygen-16 given this data. Round to the 5es001-1.jpg decimal place. mass of an oxygen-16 atom: 15.

994914 amu mass of a proton: 1.00728 amu mass of a neutron: 1.00866 amu mass defect = amu
Biology
2 answers:
Naya [18.7K]3 years ago
6 0

Answer:

Explanation:

Given parameters:

Mass of oxygen atom = 15.994914amu

Mass of a proton = 1.00728amu

Mass of a neutron = 1.00866amu

Unknown:

Mass defect = ?

From the periodic table, the number of the elementary particles in a neutral Oxygen atom is given below:

           Number of protons = 8

           Number of neutrons = 8

          Number of electrons = 8

Solution

The mass defect examines the difference between the actual mass of an atom and sum of masses of the nucleons.

The mass of an atom is concentrated in the nucleus which contains protons and neutrons. Electrons have little to no weight compared with the nucleons.

    To calculate the mass defect, we first know the mass of the nucleons first:

           1 proton has a mass of  1.00728amu

           8 protons will weigh: (8 x 1.00728)amu = 8.05824amu

For the neutrons:

          1 neutron has a mass of 1.00866amu

          8 neutrons will weigh: (8 x 1.00866)amu = 8.06928amu

Mass of the nucleons = mass of protons + mass of neutrons

                                   = 8.05824amu + 8.06928amu

                                   = 16.12752amu

The mass defect = mass of the nucleons - mass of the atom

                             = 16.12752amu - 15.994914amu

                              = 0.132606amu ≅ 0.13261amu to 5 decimal places

kondaur [170]3 years ago
4 0

Answer:

0.13261 amu.

Explanation:

Edg

You might be interested in
What is the purpose of the biochemical cycles
Mazyrski [523]
Bigeochemical cycles are variety of biological, geological, and chemical processes.

Many elements cycle through ecosystems,
organisms, air, water, and soil. Many of these are trace elements. Other elements, including carbon, nitrogen, oxygen, hydrogen, sulfur, and phosphorus are critical components of all biological life.

Because these elements are key components of life, they must be available for biological processes. The biogeochemical cycles transport and store these important elements so that they can be used by living organisms. 

hope this helps!
7 0
3 years ago
In the image below, what atom is shown in white? URGENT!!!!
Volgvan

Answer:

Pick Hydrogen, but read below.

Explanation:

The blacks are Carbon. They have 4 connections. The left Carbon has 3 whites connected to it. It is not totally an exclusive answer, but the whites could be anything in Column 17 (F, Cl, Br, I) or Hydrogen. Likely it is hydrogen.

3 0
2 years ago
Read 2 more answers
Describe the organism (physical appearance, habitat, function, history, etc.).
Mnenie [13.5K]

To put it simply these cells are technically termed as Eukaryotic (multi-celled) and Prokaryotic (single-celled) cells.
There are differences between Eukaryotic and Prokaryotic cells. This difference is considered to be the most important distinction between groups of organisms. A Prokaryotic cell does not contain a nucleus. It only contains one chromosome and is a single-celled organism. It was the only form of life on earth for millions of years. Examples of a Prokaryotic cell are the different types of bacteria present today. 
A Eukaryotic cell contains a nucleus; more than one chromosome and is typically a multi-celled organism.  Both plant and animal cells are eukaryotic cells.

<span>The advantage is that eukaryotic cells have a nucleus which functions formally as to store the DNA of the cell which can translate into many functions such as cell division and work structure between cells that forms the hierarchial function to tissues.<span>
</span></span>
8 0
2 years ago
John has two sisters and two brothers. Three of the five children in the family have dark brown hair, one has red hair, and one
Valentin [98]
The correct answer would be: Polygenetic Inheritance.

I hope that this helps you!
7 0
2 years ago
Allergies are caused by which of the following?
aniked [119]
<span>Allergies are caused by D. reactions to antigens. Antigens are some kinds of toxins that can cause a reaction in your body, and that reaction is usually in the form of an allergy. The other options do not really have much to do with allergies, but rather other forms of diseases and illnesses. </span>
3 0
2 years ago
Other questions:
  • On what basis are enzymes classified and named?
    13·2 answers
  • Can someone help me
    5·1 answer
  • Answer please ????? I will appreciate it
    15·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Kathleen has been arrested several times for shoplifting. Because she is a repeat offender, the judge requested a psychological
    5·1 answer
  • Which organisms would share the most characteristicts?
    10·1 answer
  • Identify the following statements as True or False.
    11·1 answer
  • Who can help me with the question
    9·1 answer
  • How can you determine whether an organism is a plant or organism?
    6·1 answer
  • eukaryotes that reproduce through reproduction require two cells to contribute genetic material for the production of the next g
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!