1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ArbitrLikvidat [17]
3 years ago
13

Why is it important for a person to receive a blood type and Rh factor that is compatible with his or her own blood?

Biology
2 answers:
Gnesinka [82]3 years ago
7 0

Answer:

While there are more than 20 blood-type systems, ABO and Rh are the most important ones. The importance of knowing your blood type is to prevent the risk of you receiving an incompatible blood type at a time of need, such as during a blood transfusion or during surgery.

Hope it helps  

Have a great Day : P

V125BC [204]3 years ago
5 0

Answer:

Hey!

Here's why its important:-

When a foreign antigen reaches one’s blood, it stimulates the defense  mechanism. On receiving unmatching blood, the antigen present  in the donor's blood and the antibody present in the recipient's  blood will react with each other and form a blood clot. Hence,  everyone cannot receive blood from all blood groups.

You might be interested in
Which of the following organisms are the only examples of prokaryote?
SCORPION-xisa [38]

Answer:

c. bacteria

Explanation:

8 0
3 years ago
Read 2 more answers
Which 3 beak types will most likely be present in surviving species
andriy [413]
Don’t click that link trust me
8 0
3 years ago
De que forma las investigaciones cientificas emplean el internet para conocer a los seres vivos
Shtirlitz [24]

Answer:

How scientific research uses the internet to get to know living things

Explanation:

8 0
3 years ago
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
Which of the following best summarizes the reason living things depend on oxygen? Question 6 options: Oxygen is an element of wa
Bess [88]

The correct answer is option A

Water is the most important component of all living beings. The dependence of organisms on oxygen is much because it an important component of water which is required for the survival. The various types of life processes and metabolic reactions depends on the water to take place. The body is dependent on water for it.


3 0
3 years ago
Other questions:
  • What chemical weathering agent does acid rain contain
    5·2 answers
  • Please help me ASAP
    5·1 answer
  • What is basis for all scientific explanations
    12·1 answer
  • Two or more compounds not bonded together make a
    15·1 answer
  • Explain how the shape of a river's stream bed can affect the river's speed and its power to cause erosion.
    7·1 answer
  • What type of cell is not differentiated
    15·1 answer
  • The vertebra in this photograph is from the thoracic region of the vertebral column . is it True or False​
    7·1 answer
  • What is the name of for a different froms of gene
    10·1 answer
  • TEN POINT QUESTION!!!!! 100% RIGHT ANSWERS ONLY!! Describe why the fossil record is important.
    11·2 answers
  • Two companies make baseballs and each claim that thr ball gird further. How could we design an experiment to text these claims?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!