1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DedPeter [7]
4 years ago
10

PLS HELP!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! THIS ONE IS FOR 20 POINTS. I will also give you the brainiest points?!!!!!!!!!!!wha

t cell structure uses aerobic respiration to supply energy to the cell?
Biology
1 answer:
nataly862011 [7]4 years ago
6 0

Answer:

Cytoplasm

Explanation:

Happy to help

Pls mark as Brainliest.

You might be interested in
I need help please.
Karolina [17]

Answer:

1. Can bacteria affect any cell? How does it target?

Bacteria are much larger than viruses, and they are too large to be taken up by receptor-mediated endocytosis. Instead, they enter host cells through phagocytosis. Phagocytosis of bacteria is a normal function of macrophages. They patrol the tissues of the body and ingest and destroy unwanted microbes.

2. What causes the damage to your tissues?

When the body sustains damage from trauma, disease or simple wear and tear, it normally results in the formation of a lesion or cartilage gap on your joint surface.

Explanation:

Good Morning!

7 0
3 years ago
A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
AnnyKZ [126]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

3 0
3 years ago
Which of the following is in the correct order?
zysi [14]

Answer: D. Seminiferous tubules → Epididymis → Vas deferens → Ejaculatory duct → Urethra  

Explanation:

In humans<u> sperms are produced</u> in the seminiferous tubules of the testis; and  stored momentarily in the epididymis . They swim through the   (paired )Vas deferens  to the single ejaculatory duct, to exist through the urethra  that runs the penis  length. The urethra is also the passage for urine.

4 0
3 years ago
What conclusion does this model support?
cestrela7 [59]
B because I need to do this thing too I asked my teacher and she said it was b
5 0
4 years ago
Read 2 more answers
Which of the following describes the structure of a<br> mitochondrion?
Naily [24]
Don't open that link. Anyway, can you write the rest of the question? I'd be happy to help.
4 0
3 years ago
Other questions:
  • HELP, I'LL GIVE 60 POINTS IF YOU CAN ANSWER PART F, the conclusion!!!!
    6·1 answer
  • Do arthropods vary in size? If so, by how much?
    15·1 answer
  • Why are the reaction centers of photosystems composed of several structurally different pigments?
    9·1 answer
  • Children inherit DNA from their parents. Which characteristic of DNA replication is most important in preserving the genetic cod
    14·2 answers
  • Please help me with this !!!
    5·1 answer
  • The fish pond are dying because of algal bloom. Algal bloom is caused by the presence of excess phosphorus or sulfur in the pond
    11·1 answer
  • Living things use food they eat to get______
    11·2 answers
  • Imagine you were going to build a “green” building. What features would it have? What would it look like? How would it harmonize
    6·1 answer
  • PLS HELP ME WITH THIS ADAP!!
    9·1 answer
  • HELPPPP ASAPPP!!!!!
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!